Public tenders for healthcare in Ananindeua Brazil

Find all Healthcare tenders in the world.
Finding business opportunities has never been easier.

Results for healthcare. Make a new search!

Electronic Auction - IGG kits acquisition for rubella and measles, for the Environment Section of the IEC

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published May 12, 2016

1 - FEEDER CHEMICAL KIT IGG? Rubella, METHOD ELISA SIEMENS FOR 96 TESTS. Enzygnost Anti-rubella virus IgG IgG ANTIBODY HUMAN ELISA Rubella DADE qualitative and quantitative determination of antibodies to human immunoglobulin G (IgG) against the rubella virus in serum and plasma. Presentation: Kit for 96 tests Manufacturer: Siemens Healthcare Diagnostics Inc. Brand: Siemens Healthcare Diagnostics Inc. Registration Ministry of Health number: 10345161486. ​​Meets item 1 TR SAMAM 02/2016. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 28 Unit Supply: Box 2 - FEEDER QUIMICO Enzygnost ANTI VIRUS MEASLES IGG DADE ELISA immunoassay test for the qualitative and quantitative determination of human IgG antibodies against the virus measles serum and human plasma. Presentation: 96 tests Kit Manufacturer: Siemens Healthcare Diagnostics Inc. Brand: Siemens Healthcare Diagnostics Inc. Registration Ministry of Health number: 10345161292. Meets item 2 TR SAMAM 02/2016. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 28 Unit Supply: box

Electronic Auction - Purchase of reagent kits and solutions (potassium biphthalate, IgG kit, palladium solution, determination of hormone CBA kit, etc) for the Environment Section of the IEC.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published December 4, 2015

1 - CHEMICAL FEEDER biphthalate Potassium PA, 250 grams Meets item 1 TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 2 - CHEMICAL FEEDER Sodium Carbonate Anhydrous PA, 250 grams Meets item 2 TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 3 - CHEMICAL FEEDER Sodium Nitrate PA, 250 grams Meets item 3 of the TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 4 - Ammonium Chloride CHEMICAL FEEDER PA, 250 grams Meets item 4 TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 5 - CHEMICAL FEEDER Phosphoric Acid 85% PA, 1 liter Meets item 5 of the TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 6 - CHEMICAL FEEDER Perchlorate Magnesium PA, 250 grams Meets item 5 of the TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 7 - CHEMICAL FEEDER Rubella, METHOD ELISA SIEMENS FOR 96 TESTS. Enzygnost Anti-rubella virus IgG IgG ANTIBODY HUMAN rubella DADE ELISA Qualitative and quantitative determination of antibodies to human immunoglobulin G (IgG) against the rubella virus in serum and plasma. Presentation: kit for 96 tests Manufacturer: Siemens Healthcare Diagnostics Inc. Brand: Siemens Healthcare Diagnostics Inc. Registration Ministry of Health number: 10345161486. ​​Meets item 1 TR SAMAM 99/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 28 Unit Supply: 8 boxes - CHEMICAL FEEDER MEASLES, METHOD ELISA SIEMENS FOR 96 TESTS. Enzygnost Anti measles virus IGG DADE ELISA immunoassay for the qualitative and quantitative determination of human IgG antibodies to measles virus in serum and human plasma. Presentation: 96 tests Kit Manufacturer: Siemens Healthcare Diagnostics Inc. Brand: Siemens Healthcare Diagnostics Inc. Registration Ministry of Health number: 10345161292. Meets item 2 TR SAMAM 99/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 28 Unit supplies: boxes 9 - CHEMICAL FEEDER packaged in high quality polyethylene bottle to reduce interferences and possible contamination. Meets only item TR SAMAM 100/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: Bottle 10 - CHEMICAL FEEDER kits for determination of Leptin hormone in human serum, EIA method, for 96 tests. Meets only item TR SAMAM 121/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units of delivery: Kit 11 - CHEMICAL FEEDER 550 749 Meets item 1 TR SAMAM 126/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 6 Unit of delivery: Kit 12 - CHEMICAL FEEDER 551 809 Meets item 2 TR SAMAM 126/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 6 Unit of delivery: Kit 13 - CHEMICAL FEEDER 560484 Meets item 3 of the TR SAMAM 126/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 6 Unit of delivery: kit

Electronic Auction - Purchase of laboratory equipment: kits, reagents, antibodies, etc. to the Environment Section.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published August 14, 2015

1 - METER LABORATORY BD Brand (catalog number: 340242) or similar (Item 01 SAMAM 30/2015) Differential Treatment: -. Applicability Decree 7174: No Applicability Margin of Preference: No Number: 3 Unit Supply: KIT 2 - METER LAB Brand BD (catalog number: 556 547) or similar (Item 02 SAMAM 30/2015) Differential Treatment: -. Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: KIT 3 - METER LABORATORY BD Brand (catalog number: 556463) or similar (Item 03 SAMAM 30/2015) Differential Treatment: -. Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 4 - METER LABORATORY Brand BD Pharmingen (number Catalogue number: 348 057) or similar (Item 04 SAMAM 30/2015) Differential Treatment: -. Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 5 - METER LABORATORY Brand BD Pharmingen (catalog number : 555 813) or similar. (Item 05 SAMAM 30/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 6 - METER LABORATORY Brand BD Pharmingen (catalog number: 562370) or similar. (Item 06 SAMAM 30/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 7 - METER LABORATORY Brand BD Pharmingen (catalog number: 561650) or similar. (Item 07 SAMAM 30/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 8 - METER LABORATORY Brand BD Pharmingen (catalog number: 340925) or similar. (Item 08 SAMAM 030/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 9 - METER LABORATORY Brand BD Pharmingen (catalog number: 561647) or similar. (Item 09 SAMAM 030/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 10 - METER LABORATORY Pierce Brand (Catalogue: MA5-16519) or similar. (Item 10 SAMAM 030/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Bottle 11 - METER LABORATORY Abcam Brand (ab17795) or similar. (Item 11 SAMAM 030/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 12 - METER LABORATORY Novex Mark (catalog number: M32301) or similar. (Item 12 SAMAM 030/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 13 - METER LABORATORY Novex Mark (catalog number: M32018) or similar (Item 13 SAMAM 030/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 14 - METER LABORATORY Rubella, METHOD ELISA SIEMENS FOR 96 TESTS. Enzygnost Anti-rubella virus IgG IgG ANTIBODY HUMAN rubella DADE ELISA Qualitative and quantitative determination of antibodies to human immunoglobulin G (IgG) against the rubella virus in serum and plasma. Presentation: kit for 96 tests Manufacturer: Siemens Healthcare Diagnostics Inc. Brand: Siemens Healthcare Diagnostics Inc. Registration Ministry of Health number: 10345161486 (Item 01 SAMAM 031/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 8 Unit of delivery: Kit 15 - METER LABORATORY Rubella, METHOD ELISA SIEMENS FOR 96 TESTS. Enzygnost ANTI VIRUS RUBELLA IgM DADE ELISA Enzyme immunoassay for the qualitative detection and quantitative determination of specific IgM antibodies against rubella virus in human serum and plasma. Presentation: kit for 96 tests Manufacturer: Siemens Healthcare Diagnostics Inc. Brand: Siemens Healthcare Diagnostics Inc. Registration Ministry of Health number: 10345161366 (Item 02 SAMAM 031/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 8 Unit of delivery: Kit 16 - METER LABORATORY MEASLES, METHOD ELISA SIEMENS FOR 96 TESTS. Enzygnost ANTI MEASLES VIRUS IGG DADE ELISA immunoassay test to determ

Electronic Auction - Acquisition of various inputs for laboratory use (reagent kits for determination calibrated kit, reagents for detection of certified standard reference material, QPCR kit, etc.) for the sec] s IEC

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published June 14, 2016

1 - FEEDER QUIMICO 17600114. Meets item 1 TR SABMI 01/2016. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit supply: Package 2 - FEEDER QUIMICO 17600087. Meets item 2 TR SABMI 01/2016 treatment Differentiated: - Applicability Decree 7174: No Applicability Margin preference: No Quantity: 1 Unit supply: bottle 3 - FEEDER QUIMICO 17131901. Meets item 3 TR SABMI 2016. Treatment Differential: - Applicability Decree 7174: No Applicability Margin of preference: No Quantity: 2 Unit supply: bottle 4 - FEEDER QUIMICO 25900065. Meets item 4 TR SABMI 01/2016 Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: bottle 5 - FEEDER QUIMICO 17131401. Meets item 5 TR SABMI 01 / 2016 Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: bottle 6 - FEEDER QUIMICO Cat 17131802. Meets item 6 T SABMI 01/2016 Treatment Differential: -. Applicability Decree 7174: No applicability Margin of Preference: No Quantity: 2 Unit supply: bottle 7 - FEEDER QUIMICO 17132901. Meets item7 TR SABMI 01/2016. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit Supply: Bottle 8 - FEEDER QUIMICO 25900066. Meets item 8 TR SABMI treatment Differentiated: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: bottle 9 - FEEDER QUIMICO 17133501. Meets item 9 TR SABMI 01/2016 Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 3 Unit of supply: bottle 10 - FEEDER QUIMICO 17132101. Meets item 10 TR SABMI 01/2016 Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: bottle 11 - FEEDER QUIMICO Cat 17131301. Meets item 11 TR SABMI 01 /. 2016 Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply:. bottle 12 - FEEDER QUIMICO Cat 17132301. Meets item 12 TR SABMI 01/2016 Treatment Differential: - Applicability Decree 7174: No applicability Margin of Preference: No Quantity: 2 Unit supply:. bottle 13 - FEEDER QUIMICO Cat 17132501. Meets item 13 TR SABMI 01/2016 Treatment Differential: - applicability Decree 7174: not applicable Margin of Preference: No Quantity: 1 Unit supply: bottle 14 - FEEDER QUIMICO Cat 67610165. Meets item 14 TR SABMI 01/2016 Treatment Differential: -. Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: 15 kit - FEEDER QUIMICO 17,130,202. meets item 515 TR SABMI 01/2016 Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: bottle 16 - FEEDER QUIMICO Cat 17130402. meets item 16 TR SABMI 01/2016 treatment. differentiated: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: bottle 17 - FEEDER QUIMICO 17131101. Meets item 17 TR SABMI 01/2016 treatment differentiated: - Applicability Decree 7174: No Applicability Margin of Preference : No Quantity: 1 Unit supply: bottle 18 - FEEDER QUIMICO Cat 17131201. Meets item 18 TR SABMI 01/2016 Treatment Differential: -. Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: bottle 19 - FEEDER QUIMICO 17115001. Meets item 19 TR SABMI 01/2016 Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: 20 kit - FEEDER QUIMICO 17051801. Meets item 20 TR SABMI 01/2016 Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: bottle 21 - FEEDER QUIMICO 17055402. Meets item 21 SABMI 01/2016. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Supply unit: bottle 22 - FEEDER QUIMICO 17600319. Meets item 22 TR SABMI 01/2016 treatment Differentiated: - Applicability Decree 7174: No Applicability Margin preference: No Quantity: 2 Unit supply: bottle 23 - FEEDER QUIMICO 28,932,218 Meets item 23 TR SABMI 01/2016 Treatment Differential: - Applicability Decree 7174: No Applicability Margin of preference: No Quantity: 1 Unit supply: Package 24 - FEEDER QUIMICO 29011927. Meets item 24 d

Electronic Auction - Acquisition of various laboratory use material such as Qiamp, reagents, IGG / IGM kit, Bowie test, molecular weight marker kits, etc.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published June 28, 2016

1 - Laboratory Textbook MOBILE types of samples include plasma, serum, urine, other body fluids and cell-free cell culture supernatants. (Item 01 SAARB-CIT 071/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit supply: KIT 2 - LABORATORIO Didactic MOVEL Other specifications see terms of reference. (Item 02 SAARB-CIT 071/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit supply: KIT 3 - LABORATORIO Didactic MOVEL The procedure can be fully automated in QIAcube. The purified DNA fragments with the MinElute system are ideal for sequencing applications, including next generation sequencing, microarray analysis, ligation and transformation, restriction digestion and marking. (Item 03 SAARB-CIT 071/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 4 Unit of supply: KIT 4 - LABORATORIO Didactic MOVEL

Electronic Auction - Purchase of supplies for laboratories: fungizone, enzyme immunoassay kit, hepes 1M qubit, genemol intended for research sections.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published December 7, 2015

1 - CHEMICAL FEEDER Fungizone Antimycotic liquid, sterile, filtered and bottle with 20ml Brand: Gibco or similar that meets the technical specifications (present technical data sheet) (Item 01 SEMIE 026/2015). Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: BOTTLE 2 - CHEMICAL FEEDER

Electronic Auction - Purchase of supplies for laboratory (Slide-a-lizer dialysis cassette) of the IEC Arbovirology. TR meets SAARB 51/2015.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published November 27, 2015

1 - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 1 TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 10 Supply unit: boxes 2 - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 2 TR SAARB 51/2015 Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: 3 boxes - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 3 of the TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 10 Supply unit: 4 boxes - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 4 TR SAARB 51/2015 Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units of delivery: 5 boxes - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 5 of the TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: 6 boxes - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 6 TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 10 Supply unit: 7 boxes - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 7 T SAARB 51/2015 Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Roll 8 - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 8 TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit Supply: roller 9 - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 9 TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Package 10 - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 10 of the TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 10 Supply unit: Pack 11 - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Item meets 11 TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: Package 12 - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Item meets 12 TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: Package 13 - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Meets item 13 of the TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Package 14 - CHEMICAL FEEDER Deal with it to be delivered in compliance with the manufacturer's suggestions. Item meets 14 TR SAARB 51/2015. Differential Treatment: Type I - Exclusive participation of ME / EPP Applicability Decree 7174: No Applicability Margin of Preference: No Number: 10 units supply: boxes 15 - FEEDER CHEMICAL Deal with it to be delivered in compliance with the manufacturer's suggestions Meets item 15 TR SAARB 51/2015. Differential Treatment: - Applicability D

Electronic Auction - Purchase of reagents, kits, qiamp, fetal serum, super script, luria medium weight marker, etc.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published August 18, 2015

1 - To attempt METER LABORATORY for it to be delivered in compliance with the manufacturer's suggestions. (Item 01 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Box 2 - To attempt METER LABORATORY for it to be delivered in compliance with the manufacturer's suggestions. (Item 02 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 3 - To attempt METER LABORATORY for it to be delivered in compliance with the manufacturer's suggestions (Item 03 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 4 - To attempt METER LABORATORY for it to be delivered in compliance with the manufacturer's suggestions. (Item 04 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 5 - To attempt METER LABORATORY for it to be delivered in compliance with the manufacturer's suggestions. (Item 05 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 6 - METER LABORATORY Deal with it to be delivered in compliance with the manufacturer's suggestions. (Item 06 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 7 - METER LABORATORY Deal with it to be delivered in compliance with the manufacturer's suggestions. (Item 07 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 8 - METER LABORATORY Deal with it to be delivered in compliance with the manufacturer's suggestions. (Item 08 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 9 - METER LABORATORY Deal with it to be delivered in compliance with the manufacturer's suggestions. (Item 09 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 10 - METER LABORATORY Deal with it to be delivered in compliance with the manufacturer's suggestions. (Item 10 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 11 - METER To attempt LABORATORY for it to be delivered in compliance with the manufacturer's suggestions. (Item 11 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: Box 12 - METER LABORATORY Each unit has 50 preps. Brand: Invitrogen - K2100-15 Code Presentation: Box of 50 preps. Tip: Invitrogen Brand - Code: K2100-15 or similar (Item 12 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: Box 13 - METER To attempt to LAB the same is delivered in compliance with the manufacturer's suggestions. (Item 13 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 14 - METER To attempt LABORATORY for it to be delivered in compliance with the manufacturer's suggestions. (Item 14 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Tube 15 - METER To attempt LABORATORY for it to be delivered in compliance with the manufacturer's suggestions. (Item 15 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Tube 16 - METER LABORATORY Deal with it to be delivered in compliance with the manufacturer's suggestions. (Item 16 SAARB 52/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Tube 17 - METER To attempt LABORATORY for it to be delivered in compliance with the manufacturer's suggestions. (Item 17 SAARB 52/2015) Differential Treatment: - From Applicability

Electronic Auction - Purchase of materials for laboratory investigations (Parafilm, formaldehyde, kits, ointment, solution, permanganate, etc.).

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published January 16, 2015

Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 3 - INSTRUMENTO PARA ANALISE CLINICA (Item 03 SAMAM 83/2014) Heparina sódica 250 mg, marca Applichem ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: Frasco 4 - INSTRUMENTO PARA ANALISE CLINICA (Item 04 SAMAM 83/2014) Solução de Denhardts, 50x concentrada, frasco 50 ml, marca Amresco ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 5 - INSTRUMENTO PARA ANALISE CLINICA (Item 05 SAMAM 83/2014) Hidróxido de Bário, monohidratado, 500 g, Marca Alfa Aesar ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 6 - INSTRUMENTO PARA ANALISE CLINICA (Item 06 SAMAM 83/2014) Cloreto de sódio, 1 kg, Marca Amresco, Sigma-Aldrich ou similar. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 7 - INSTRUMENTO PARA ANALISE CLINICA (Item 07 SAMAM 83/2014) Bicarbonato de sódio, 1 Kg, marca Amresco, Sigma-Aldrich ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 8 - INSTRUMENTO PARA ANALISE CLINICA (Item 08 SAMAM 83/2014) Fosfato de sódio Monobásico ACS Monohidratado, 1 Kg, Marca Sigma-Aldrich ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 9 - INSTRUMENTO PARA ANALISE CLINICA (Item 09 SAMAM 83/2014) Paraformaldeido, Grau reagente, 500 g, Marca Amresco, Sigma-Aldrich ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 10 - INSTRUMENTO PARA ANALISE CLINICA (Item 10 SAMAM 83/2014) Cacodilato de Sódio Trihidratado 100g, marca Amresco ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 11 - INSTRUMENTO PARA ANALISE CLINICA (Item 11 SAMAM 83/2014) Dietileno Glicol pureza >99% 1 Litro, marca Amresco ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 12 - INSTRUMENTO PARA ANALISE CLINICA (Item 12 SAMAM 83/2014) Fosfato de sódio dibásico ACS Anidro, 1 Kg, marca Amresco ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 13 - INSTRUMENTO PARA ANALISE CLINICA (Item 13 SAMAM 83/2014) Sulfato de Dextrano, 250g, Marca amresco ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 14 - INSTRUMENTO PARA ANALISE CLINICA (Item 14 SAMAM 83/2014) Tampão TBE 9Tris Borato EDTA) 10x, 1 litro, marca Amresco ou similar. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: Frasco 15 - INSTRUMENTO PARA ANALISE CLINICA (Item 15 SAMAM 83/2014) D-Glucose (Dextrose) Anidra. 500g, Marca Amresco ou similar Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 16 - INSTRUMENTO PARA ANALISE CLINICA (Item 01 SAPAR 008/2014) Kit para purificação de DNA ?Wizard PCR Preps DNA Purification System? para 250 reações, conservação a temperatura ambiente. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 17 - INSTRUMENTO PARA ANALISE CLINICA (Item 02 SAPAR 008/2014) Primer ETTS 1-5?-TGC TTA AGT TCA GCG GGT ? 3?, 100nm. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 18 - INSTRUMENTO PARA ANALISE CLINICA (Item 03 SAPAR 008/2014) Primer ETTS 2 ? 5?- TAA CAA GGT TTC CGT AGG TGA A ? 3?, 100nm. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 19 - INSTRUMENTO PARA ANALISE CLINICA (Item 04 SAPAR 008/2014) Nuclease free Water (Água bi-destilada estéril para PCR), frasco 250ml. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Frasco 20 - INSTRUMENTO PARA ANALISE CLINICA (Item 05 SAPAR 008/2014) Enzima de restrição DdeI seqüência de reconhecimento 5 C/TNAG, aproximadamente 100Unid. Frasco Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Frasco 21 - INSTRUMENTO PARA ANALISE CLINICA (Item 06 SAPAR 008/2014) Álcool Isoamílico, P.A., para extração de DNA, 25 ml, frasco Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 22 - INSTRUMENTO PARA ANALISE CLINICA (Item 07 SAPAR 008/2014) Kit Wizard Genomic DNA purification, 500 reações. Catálogo A1125. Marca Promega. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Kit 23 - INSTRUMENTO PARA ANALISE CLINICA (Item 08 SAPAR 008/2014) Formaldeído P.A., 1 litro. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 24 - INSTRUMENTO PARA ANALISE CLINICA (Item 09 SAPAR 008/2014) Marcador de peso molecular de 100 pb (pares de bases). Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 25 - INSTRUMENTO PARA ANALISE CLINICA (Item 10 SAPAR 008/2014) AmpliTaq Gold DNA Polymerase.Unidade Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 26 - INSTRUMENTO PARA ANALISE CLINICA (Item 11 SAPAR 008/2014) Acrilamida Ultra Pura. Frasco contendo 500 g. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 27 - INSTRUMENTO PARA ANALISE CLINICA (Item 12 SAPAR 008/2014) Agarose Ultra Pura. Frasco contendo 500 g. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 28 - INSTRUMENTO PARA ANALISE CLINICA (Item 13 SAPAR 008/2014) DNTP incluindo dUTP (4 x 100mM de dATP, dCTP, dGTP e dTTP), 4 x 200 ?l dNTP.Unidade Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Unidade 29 - INSTRUMENTO PARA ANALISE CLINICA (Item 14 SAPAR 008/2014) Enzima de restrição DdeI. 1000 unidades, sendo a concentração, 10 u/?l. Frasco Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Frasco 30 - INSTRUMENTO PARA ANALISE CLINICA (Item 15 SAPAR 008/2014) EDTA 1 Kg. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 31 - INSTRUMENTO PARA ANALISE CLINICA (Item 16 SAPAR 008/2014) Solução de Precipitação Proteica 25 ml. Cat. A7951. Marca: Promega Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 32 - INSTRUMENTO PARA ANALISE CLINICA (Item 17 SAPAR 008/2014) Nitrato de prata 500g Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 33 - INSTRUMENTO PARA ANALISE CLINICA (Item 18 SAPAR 008/2014) Óleo mineral, frasco. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 34 - INSTRUMENTO PARA ANALISE CLINICA (Item 19 SAPAR 008/2014) Enzima Platinum Taq DNA Polimerase. Marca Invitrogen, tubo com 500 unidades. Número catálogo: 10966030. Unidade: Kit Taq + tampão. Unidade Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 35 - INSTRUMENTO PARA ANALISE CLINICA (Item 20 SAPAR 008/2014) Persulfato de amônia ? 100gr, frasco. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 36 - INSTRUMENTO PARA ANALISE CLINICA (Item 21 SAPAR 008/2014) Proteinase K - 100 mg (liofilizada), unidade Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 37 - INSTRUMENTO PARA ANALISE CLINICA (Item 22 SAPAR 008/2014) Tampão (10x) STR. Marca Promega. Código: DM 2211. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 38 - INSTRUMENTO PARA ANALISE CLINICA (Item 23 SAPAR 008/2014) Enzima Taq DNA polimerase HotMaster - tubo com 100 unidades. Marca EPPENDORF. Catálogo: 0032 002.676. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 39 - INSTRUMENTO PARA ANALISE CLINICA (Item 24 SAPAR 008/2014) Tris-HCL pote de 500g - Tris(hydroxymethyl) aminomethane hydrochloride. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 40 - INSTRUMENTO PARA ANALISE CLINICA (Item 25 SAPAR 008/2014) ExoSAP-IT: Purificador de Produtos da PCR baseado em Exonuclease I e Shrimp Alkaline Phosphatase . Catálogo: US 78201. 500 reações. Marca: AMERSHAM BIOSCIENCES. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 41 - INSTRUMENTO PARA ANALISE CLINICA (Item 26 SAPAR 008/2014) TOPO TA Cloning kit for sequencing´ Kit de sequenciamento TOPO TA. Catálogo número K 4575-01/ SC. Marca: INVITROGEN. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 42 - INSTRUMENTO PARA ANALISE CLINICA (Item 27 SAPAR 008/2014) Dyenamic Et Dye Terminator Kit´, 500 reações. Catálogo US.81.090, marca AMERSHAM BIOSCIENCES. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 43 - INSTRUMENTO PARA ANALISE CLINICA (Item 28 SAPAR 008/2014) Kit Geneclean II para purificação de DNA em géis e soluções. 300 reações. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 44 - INSTRUMENTO PARA ANALISE CLINICA (Item 29 SAPAR 008/2014) Skirted 96 PCR PLATE. Número catálogo: 23080. Marca Sorenson Bioscience. Caixa com 25 unidades. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Caixa 45 - INSTRUMENTO PARA ANALISE CLINICA (Item 30 SAPAR 008/2014) Temed, 50 ml marca Promega, Número Catálogo: V3161. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 46 - INSTRUMENTO PARA ANALISE CLINICA (Item 31 SAPAR 008/2014) Xgal: 100 mg, sendo a concentração, 50 mg/ml. Código: v3941. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 47 - INSTRUMENTO PARA ANALISE CLINICA (Item 32 SAPAR 008/2014) 1 Kb DNA Ladder (padrão de peso molecular) 500 l (100 canaletas). Descrição: apresentar 13 fragmentos de tamanhos variando de 250 a 10.000 pares de base e variação de 500 a 1500 pb entre cada fragmento. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 48 - INSTRUMENTO PARA ANALISE CLINICA (Item 33 SAPAR 008/2014) Enzima Bst 2.0 DNA Polymerase,M0537L, New England. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Unidade 49 - INSTRUMENTO PARA ANALISE CLINICA (Item 34 SAPAR 008/2014) Enzima Bst DNA Polymerase, Large Fragment - 8.000 unidade, M0275L, New England . Unidade Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 50 - INSTRUMENTO PARA ANALISE CLINICA (Item 35 SAPAR 008/2014) Betaína 1 Vl, B0300, Marca Sigma. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Unidade 51 - INSTRUMENTO PARA ANALISE CLINICA (Item 36 SAPAR 008/2014) Solução de Sulfato de Magnésio Magnesium Sulfate (MgSO4) Solution, B1003S, New England . Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Unidade 52 - INSTRUMENTO PARA ANALISE CLINICA (Item 37 SAPAR 008/2014) Set of dATP, dCTP, dGTP, dTTP (Conjunto de dexoxirribonucleotídeo,40 mol cada),U1240,Promega. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Unidade 53 - INSTRUMENTO PARA ANALISE CLINICA (Item 38 SAPAR 008/2014) Destilador de água, Distilled Water (Ultra Pure), Frs. c/500ml, 10977015, Marca Life. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: Unidade 54 - INSTRUMENTO PARA ANALISE CLINICA (Item 39 SAPAR 08/2014) Corante HNB(Hidroxinaftol Blue),frs. c/10g, 33936, Marca Sigma. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Unidade 55 - INSTRUMENTO PARA ANALISE CLINICA (Item 40 SAPAR 08/2014) Corante Sybr Green l dye, S7563 ,Marca Life. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Unidade 56 - INSTRUMENTO PARA ANALISE CLINICA (Item 41 SAPAR 08/2014) 100bp DNA Ladder, 50 lanes, G2101, Promega. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 57 - INSTRUMENTO PARA ANALISE CLINICA (Item 42 SAPAR 08/2014) PhiX174 DNA/HaeIII Markers, 50 lanes, G1761, Promega. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Unidade 58 - INSTRUMENTO PARA ANALISE CLINICA (Item 43 SAPAR 08/2014) Enzima GoTaq DNA Polymerase,500 u, M3005 ,Promega. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Unidade 59 - INSTRUMENTO PARA ANALISE CLINICA (Item 44 SAPAR 08/2014) Solução de cloreto de magnésio, Magnesium Chloride Solution, 25 ml, A3513, Promega. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: Unidade 60 - INSTRUMENTO PARA ANALISE CLINICA (Item 45 SAPAR 08/2014) Acrilamida, Acrylamide, Molecular Grade, 500 g, V3115, Promega. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 61 - INSTRUMENTO PARA ANALISE CLINICA (Item 46 SAPAR 08/2014) Reagente de purificacao dna ,instagene Matrix, 7326030, BIO-RAD. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: Unidade 62 - INSTRUMENTO PARA ANALISE CLINICA (Item 47 SAPAR 08/2014) Oligonucleotideo,IDT, L Oligo FIP Sm28S,1 ?mole Purificação: Standard Desalting Sequência: 5´- GCC ACC CTA AAC ACC ACA TTG CTG AAC AGG GAT TAG CCC AAC -3´ Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 63 - INSTRUMENTO PARA ANALISE CLINICA (Item 48 SAPAR 08/2014) Oligonucleotideo,IDT,L Oligo BIP Sm28S,1 ?mole Purificação: Standard Desalting Sequência: 5´- CAG GCA TTA CTG CTC TGT CCC AGG GCC TTT CAC CCT CTT TG -3´ Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 64 - INSTRUMENTO PARA ANALISE CLINICA (Item 49 SAPAR 08/2014) Oligonucleotideo,IDT L Oligo F3 Sm28S, 1 ?mole Purificação: Standard Desalting Sequência: 5´- GGA TTC CCC TAG TAA CTG CG -3´ Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 65 - INSTRUMENTO PARA ANALISE CLINICA (Item 50 SAPAR 08/2014) Oligonucleotideo,IDT L Oligo B3 Sm28S, 1 ?mole Purificação: Standard Desalting Sequência: 5´- ACT TGA TCT CTG CCC CCA C -3´ Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 66 - INSTRUMENTO PARA ANALISE CLINICA (Item 51 SAPAR 08/2014) Oligonucleotideo,IDT PCR Oligo 121F, 1 ?mole Purificação: Standard Desalting Sequência: 5´- GAT CTG AAT CCG ACC AAC CG -3´ Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 67 - INSTRUMENTO PARA ANALISE CLINICA (Item 52 SAPAR 08/2014) Oligonucleotideo,IDT PCR Oligo 121R, 1 ?mole Purificação: Standard Desalting Sequência: 5´- ATA TTA ACG CCC ACG CTC TC -3´ Unidade Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 68 - INSTRUMENTO PARA ANALISE CLINICA (Item 53 SAPAR 08/2014) Oligonucleotideo,IDT PCR Oligo Alfa tubF, 1 ?mole Purificação: Standard Desalting Sequência: 5´- TAT CCA CTT CCC GTT GGC TAC C -3´ Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 69 - INSTRUMENTO PARA ANALISE CLINICA (Item 54 SAPAR 08/2014) Oligonucleotideo,IDT PCR Oligo Alfa tubR, 1 ?mole, Purificação: Standard Desalting Sequência: 5´- ACG AGG GTC ACA TTT CAC CAT -3´ Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 70 - INSTRUMENTO PARA ANALISE CLINICA (Item 55 SAPAR 08/2014) SYBR Safe DNA Gel Stain, 400?l, S33102, Invitrogen by Life. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 71 - INSTRUMENTO PARA ANALISE CLINICA (Item 56 SAPAR 08/2014) Tampão TAE 50x TAE Buffer,1000ml, 24710-030, Invitrogen by Life. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: Unidade 72 - INSTRUMENTO PARA ANALISE CLINICA (Item 57 SAPAR 08/2014) 10X BlueJuice? Gel Loading Buffer 10816-015, Invitrogen by Life. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Unidade 73 - INSTRUMENTO PARA ANALISE CLINICA (Item 58 SAPAR 08/2014) E-Gel EX Agarose Gels Starter Kit, 2%, G6512ST, Invitrogen by Life. Unidade. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: Unidade 74 - INSTRUMENTO PARA ANALISE CLINICA (Item 59 SAPAR 08/2014) 100 bp DNA Ladder,50 g, 15628-019, Invitrogen by Life. Unidade. Padrão de peso molecular Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 75 - INSTRUMENTO PARA ANALISE CLINICA (Item 60 SAPAR 08/2014) Iniciador G7 (5?AAGCCCGACGACCTCACCCGCAGTGC3?) (100 mM). Frasco Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 76 - INSTRUMENTO PARA ANALISE CLINICA (Item 61 SAPAR 08/2014) Iniciador G759 (5?GAGGCCGCCCTGGATCTTCGAGACGAC3?) (100 mM). Frasco Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 77 - INSTRUMENTO PARA ANALISE CLINICA (Item 62 SAPAR 08/2014) Iniciador G376 (5?CATAACGACGCCATCGCGGCTCTCAGGAA3?) (100 mM) Frasco Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 78 - INSTRUMENTO PARA ANALISE CLINICA (Item 63 SAPAR 08/2014) Enzima de restrição HaeIII. Frasco com 10.000 unidades. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 79 - INSTRUMENTO PARA ANALISE CLINICA (Item 64 SAPAR 08/2014) Enzima de restrição HhaI. Frasco com 10.000 unidades. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: Frasco 80 - INSTRUMENTO PARA ANALISE CLINICA (Item 65 SAPAR 08/2014) Taq hot start, 5 U/?L, contendo cloreto de magnésio 25 mM e tampão sem cloreto de magnésio, frasco com 250 unidades Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Frasco 81 - INSTRUMENTO PARA ANALISE CLINICA (Item 66 SAPAR 08/2014) Kit para purificação de DNA - GFX? PCR DNA and gel band purification kit (GE Healthcare?) para 100 aplicações. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Kit 82 - INSTRUMENTO PARA ANALISE CLINICA (Item 67 SAPAR 08/2014) Enzima proteinase k, liofilizada, livre de atividade DNAse, Nickase e RNAse. PM: 28,93 kDa. Frasco contendo 100 mg. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Frasco 83 - INSTRUMENTO PARA ANALISE CLINICA (Item 01 SAPAR 65/2014) Bálsamo do Canadá incolor, natural, para microscopia. Frasco com 100 mL Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: Frasco 84 - INSTRUMENTO PARA ANALISE CLINICA (Item 02 SAPAR 65/2014) Extrato de fígado bovino em pó, dessecado, para uso em preparação de meio de cultura microbiológico REF 213320. Frasco com 500g Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: Frasco 85 - INSTRUMENTO PARA ANALISE CLINICA (Item 01 SAPAR 70/2014) Pomada Nebaciderme ?Sulfato de Neomicina 5mg/g ?Bacitracina Zincica 250m/g. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1000 Unidade de fornecimento: Unidade 86 - INSTRUMENTO PARA ANALISE CLINICA (Item 02 SAPAR 70/2014) Permanganato de Potássio Sachês 120 g. Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: Unidade

Electronic Auction - Purchase of supplies for laboratory for various sections. See Notice (PBS PARASITOLOGIAS, PATHOLOGY, BACTERIOLOGY and ENVIRONMENT).

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published March 4, 2015

1 - ANALYSIS TOOL FOR CLINIC potassium Acetat (C2H3KO2) M = 98.15 bottle with 500 (Item 1 of PBS SAPAR 62/2014) Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: Bottle 2 - ANALYSIS TOOL FOR CLINIC Diethylpyrocarbonate (diethyl pyrocarbonate) C6H10O5, MW = 162.141frasco with 25ml (Item 2 of the PBS SAPAR 62/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 3 - ANALYSIS TOOL FOR CLINIC Spermidine (C7H19N3) M = 145.25 bottle with 5g (Item 03 of PBS SAPAR 62/2014 ). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 4 - ANALYSIS TOOL FOR CLINIC Trizma hydrochloride Sigma - T5941 (MW = 157.60) bottle with 500g (Item 04 of PBS SAPAR 62/2015). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 5 - ANALYSIS TOOL FOR CLINIC Sucrose (C12H22O11) M = 342.30 bottle with 500g (Item 05 of PBS SAPAR 62/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 6 - ANALYSIS TOOL FOR CLINIC EDTA (C10H16N2O8) M = 292.2 bottle with 500g (Item 06 of PBS SAPAR 62/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 7 - ANALYSIS TOOL FOR CLINIC bottle with 1 kg. (Item 07 of PBS SAPAR 62/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Supply Unit: Bottle 8 - ANALYSIS TOOL FOR CLINIC bottle with 500g. (Item 08 of PBS SAPAR 562/2014) Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 9 - ANALYSIS TOOL FOR CLINIC bottle with 500g. (Item 9 of PBS SAPAR 62/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 10 - ANALYSIS TOOL FOR CLINIC Applications: conventional electrophoresis: can be used in various concentrations; Electrophoresis, pulsed-field gel: due to its high limit exclusions, larger molecules can be separated; Blotting; Preparation of agarose beads; Enzyme immobilization and cell - bottle with 500 g (Item 01 of PBS SAPAR 96/2014).. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 11 - DRINKING WATER bottle of 250 ml. (Item 2 of the PBS SAPAR 96/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 12 - ANALYSIS TOOL FOR CLINIC compound for preparation of reagents. (Item 03 of PBS SAPAR 96/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 13 - ANALYSIS TOOL FOR CLINIC dNTPs Sets (adenine, thymine, guanine and cytosine), 100 mM DNTP set (4/250 uL) (Item 04 of PBS SAPAR 96/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 3 Unit of supply: Set 14 - DYE 15% soluble in water (5%, 20 ° C) (Item 05 of PBS SAPAR 96/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 15 - ANALYSIS TOOL FOR CLINIC enzyme Platinum Taq DNA polymerase (500 U) - (5U / uL) (Item 06 of PBS SAPAR 96/2014) Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 3 Unit of supply: Bottle 16 - ANALYSIS INSTRUMENT CLINIC Taq DNA Polymerase Enzyme bottle with 500 units (5U / uL) (Item 07 PBS SAPAR 96/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 17 - ANALYSIS TOOL FOR CLINIC GelRed 10,000 × 0.5 ml in water (Item 08 of PBS SAPAR 96/2014). Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit Supply of
  • 1