Public tenders for chemical in Pelotas Brazil

Find all Chemical tenders in the world.
Finding business opportunities has never been easier.

Results for chemical. Make a new search!

chemical material acquisition

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO | Published April 17, 2017  -  Deadline April 28, 2017

Object: Electronic Auction - chemical material acquisition

Inquisition of chemical material.

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO | Published October 3, 2017  -  Deadline October 16, 2017

Object: Electronic Auction - Inquisition of chemical material.

Consumables: chemical reagents and the like.

MINISTÉRIO DA EDUCAÇÃO | Published July 27, 2017  -  Deadline August 10, 2017

Object: Electronic Trading - Consumables: chemical reagents and the like.

Acquisition of chemical reagents for laboratories

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO | Published May 7, 2018  -  Deadline May 17, 2018

Object: Electronic Auction - Acquisition of chemical reagents for laboratories

chemical material acquisition laboratory use

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO | Published October 18, 2016  -  Deadline October 31, 2016

Object: Electronic Auction - chemical materials Acquisition laboratory use

Acquisition of chemical material and agricultural inputs.

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO | Published April 24, 2017  -  Deadline May 8, 2017

Object: Electronic trading - Acquisition of chemical material and agricultural inputs.

Electronic Auction - Purchase of chemical reagents

MINISTÉRIO DA EDUCAÇÃO, Universidade Federal de Pelotas, Pró-Reitoria Administrativa, | Published September 9, 2016

1 to 2.4-dinitrophenylhydrazine (2,4-DNPH) 2,4-dinitrophenylhydrazine (2,4-DNPH), APPEARANCE PHYSICAL CRYSTALLINE POWDER ORANGE OR RED, CHEMICAL FORMULA C6H6N4O4, MOLECULAR WEIGHT 198.14 G / MOL, CONTENT pURITY pURITY oF MINIMUM 97% FEATURE ADDITIONAL ANALYTICAL REAGENT, REFERENCE NUMBER CHEMICAL CAS 119-26-6 treatment Differential: Type I - Exclusive participation of ME / EPP Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: BOTTLE 100.00 G 2 - acetanilide acetanilide, APPEARANCE PHYSICAL WHITE cRYSTALLINE POWDER, ODOURLESS, CHEMICAL FORMULA C8H9NO, MOLECULAR WEIGHT 135.17 G / MOL, pURITY DEGREE OF pURITY LEAST 99% FEATURE ADDITIONAL REAGENT PA, REFERENCE NUMBER CHEMICAL CAS 103- 84-4 Treatment Differential: Type I - Exclusive participation of ME / EPP Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 25 Unit supply: GRASS 3 - ACETATE aMMONIUM ACETATE aMMONIUM, BASIC COMPOSITION NH4C2H3O2 , APPEARANCE PHYSICAL WHITE CRYSTAL, MOLECULAR WEIGHT 77.08 G / MOL, PURITY PURITY MINIMUM MINIMUM 98% ADDITIONAL FEATURES REAGENT PA, REFERENCE NUMBER CHEMICAL CAS 63161-8 Treatment Differential: Type I - Exclusive participation of ME / EPP Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 250 Unit supply: GRASS 4 - aCETATE eTHYL aCETATE eTHYL, APPEARANCE PHYSICAL LIQUID COLOURLESS, limpid, FLAMMABLE, pURITY MINIMUM MINIMUM pURITY oF 99% CHEMICAL COMPOSITION CH3CO2C2H5, MOLECULAR WEIGHT 88 , 1G / MOL, FEATURE ADDITIONAL REAGENT PA, REFERENCE NUMBER CHEMICAL CAS 141-78-6 treatment Differential: Type I - Exclusive participation of ME / EPP Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 18 Unit supply : LITER 5 - ACETONE

Electronic Auction - chemical material acquisition

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO, Empresa Brasileira de Pesquisa Agropecuária, Embrapa/CPACT, | Published May 14, 2015


Electronic Auction - Purchase of chemical material and laboratory

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO, Empresa Brasileira de Pesquisa Agropecuária, Embrapa/CPACT, | Published December 3, 2015

1 - Perchloric acid ACS, REFERENCE NUMBER CHEMICAL CAS 7601-90-3 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 4 Unit of supply: 2 LITER - ETHANOL ACS ISO, REFERENCE NUMBER CHEMISTRY CAS 64-17-5 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 6 Unit of supply: LITER 3 - ALCOHOL METHYL ALCOHOL METHYL, PHYSICAL ASPECT LIQUID clear, colorless, ODOR CHARACTERISTIC, CHEMICAL FORMULA CH 3 OH ANHYDROUS , MOLECULAR WEIGHT 32.04 G / MOL, PURITY DEGREE OF PURITY OF MINIMUM 99.8% FEATURE ADDITIONAL Reagent PA, REFERENCE NUMBER CHEMICAL CAS 67-56-1 Differential Treatment: - Decree 7174 Applicability: Applicability No Preference margin: No Number: 40 Unit Supply: LITER 4 - COTTON COTTON TYPE ABSORBENT, PRESENTATION MANTAS, TARGETED MATERIAL, PURIFIED, IMPURITIES-FREE, ADDITIONAL FEATURES WRAPPED IN PROPER ROLE, sterility NOT STERILE, TYPE PACKING INDIVIDUAL PACKING Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit Supply: PACKAGE 500.00 G 5 - EXTRACT DYE S2004 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: BOTTLE 6 - BOTTLE Shipping BALLOON VOLUMETRIC CAP. 10ML WITH COVER POLYPROPYLENE Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 8 Unit of supply: UNIT 7 - CYCLOHEXANE CYCLOHEXANE, PHYSICAL ASPECT LIQUID LIGHT, COLOURLESS, ODOR CHARACTERISTIC, MOLECULAR WEIGHT 84.16 G / MOL CHEMICAL FORMULA C6H12, PURITY DEGREE OF PURITY OF MINIMUM 99.5% FEATURE ADDITIONAL Reagent PA / ACS ISO, REFERENCE NUMBER CHEMICAL CAS 110-82-7 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 10 Unit Supply: 8 LITER - CHLORIDE CHLORIDE MN MN, PHYSICAL ASPECT POWDER FINE, CRYSTAL CLEAR, PINK, MOLECULAR WEIGHT 179.91 G / MOL CHEMICAL FORMULA MNCL2.4H2O (tetrahydrate), PURITY DEGREE OF PURITY OF MINIMUM 99% ADDITIONAL FEATURE Reagent PA, REFERENCE NUMBER CHEMICAL CAS 13446-34-9 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 500 Unit Supply: 9 GRASS - EXTRACT DYE Powder, Chemical formula CH 3 (CH2) 11OSO3Na, Molecular Weight 288.38, CAS 151-21-3 BOTTLE WITH 25 GRAMS Reference: Sigma-Aldrich Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: BOTTLE 10 - BOTTLE Expedition 250ML HEAT Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 6 Unit of supply: UNIT 11 - SPATULA LABORATORY LABORATORY SPATULA, MATERIAL STAINLESS STEEL, FLAT FORMAT WITH SPOON, COMPRIMENTOCERCA OF 15 CM Treatment Differential : - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 4 Unit of supply: UNIT 12 - Shipping BOTTLE SHELF (SUPPORT) FOR 24 PIPE DIAMETER PACKED 20MM TEST ON WIRE AND COATED IN PVC Treatment Differential: - Applicability Decree 7174: Not applicable Margin of Preference: No Quantity: 2 Unit of supply: UNIT 13 - Shipping BOTTLE SHELF (SUPPORT) FOR 60 PIPE DIAMETER PACKED 20MM TEST ON WIRE AND COATED IN PVC Treatment Differential: - applicability Decree 7174: There Applicability Margin of Preference: No Quantity: 2 Unit of supply: UNIT 14 - diethyl ether ANHYDROUS, REFERENCE NUMBER CHEMICAL CAS 60-29-7 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 4 unit of delivery: 15 LITER - barium hydroxide barium hydroxide, PHYSICAL APPEARANCE WHITE POWDER, ODOURLESS, MOLECULAR WEIGHT 315.48 gmol, CHEMICAL FORMULA BA (OH) 2.8H20, PURITY DEGREE OF PURITY OF MINIMUM 98% ADDITIONAL FEATURE Reagent PA, REFERENCE NUMBER CHEMICAL CAS 1223071-6 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 500 Unit Supply: GRASS 16 - Potassium iodide Potassium iodide, PHYSICAL APPEARANCE WHITE POWDER, CRYSTAL, INODORO , CHEMICAL FORMULA KI, MOLECULAR WEIGHT 166.01 G / MOL, PURITY CONTENT OF PURITY OF MINIMUM 99% ADD FEATURE

Electronic Auction - laboratory equipment Acquisition and chemical reagents

MINISTÉRIO DA EDUCAÇÃO, Universidade Federal de Pelotas, Pró-Reitoria Administrativa, | Published June 22, 2016

1 - ACETIC ACID ACETIC, APPEARANCE PHYSICAL clear liquid TRANSPARENT, MOLECULAR WEIGHT 60.05 G / MOL CHEMICAL FORMULA C2H4O2, PURITY DEGREE OF PURITY LEAST 99.7% ADDITIONAL FEATURE GLACIER, REAGENT PA-ACS-ISO, NUMBER REFERENCE CHEMICAL CAS 64-19-7 Treatment Differential: Type I - Exclusive participation of ME / EPP Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit supply: LITER 2 - hYDROCHLORIC ACID hYDROCHLORIC ACID, APPEARANCE PHYSICAL clear liquid , COLOURLESS / yellowish, smoky, MOLECULAR WEIGHT 36.46 G / MOL CHEMICAL FORMULA HCL CONTENT CONTENT MINIMUM OF 37% pURITY DEGREE OF pURITY LEAST 99% FEATURE ADDITIONAL REAGENT PA / ACS, REFERENCE NUMBER CHEMICAL CAS 7647- 01-0 Treatment Differential: Type I - Exclusive participation of ME / EPP Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit supply: LTR 3 - PHOSPHORIC ACID

Possible acquisition of laboratory supplies - chemical reagents for the Laboratory of Clinical Analysis of PMGu / Pel

MINISTÉRIO DA DEFESA | Published October 27, 2017  -  Deadline November 9, 2017

Object: Electronic Auction - Possible acquisition of laboratory supplies - chemical reagents for the Laboratory of Clinical Analysis of PMGu / Pel

Electronic Auction - Purchase of chemical material, supplies and protective equipment and safety

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO, Empresa Brasileira de Pesquisa Agropecuária, Embrapa/CPACT, | Published August 7, 2015

1 - EXTRACT DYE INSECTICIDE abamectin, FOR CONCENTRATION 1.8 V, CONCENTRATE PRESENTATION emulsifiable, REFERENCE NUMBER CHEMICAL CAS 71751-41-2 MARK Vertimec COMMERCIAL BR0381082 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 5 supply unit: LITER 2 - CHEMICAL FERTILIZER BR 72010 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 20 Unit of supply: BAG 50.00 KG 3 - ALUMINUM LADDER LADDER FRUIT, HEIGHT 5 METERS Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 1 supply unit: UNIT 4 - SCREEN DISPLAY BRAIDED GALVANIZADA 6/14 (1.20m X 1.40m) Differential Treatment: - Applicability Decree 7174: not Applicability Margin of Preference: No Number: 168 Unit Supply: 5 square meter - FERTILIZER CHEMICAL FERTILIZER BAG CALCIUM NITRATE WITH 50KG Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 15 Unit of supply: BAG 50.00 KG 6 - CHEMICAL FERTILIZER BR 72010 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: BAG 50.00 KG 7 - CHEMICAL FERTILIZER BR 72010 Differential Treatment: - Applicability Decree 7174 Do not Applicability Margin of Preference: No Number: 10 units supply: BAG 50.00 KG 8 - FERTILIZER UREA FERTILIZER UREA, CHEMICAL COMPOSITION PER NITROGEN 46, GRANULADO PRESENTATION, WHITE COLOUR, 36 MONTH PERIOD VALID, PLANTING APPLICATION, FEATURES ADDITIONAL hygroscopic / INSTANT WATER / ALCOHOL AND BENZINA Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 12 Unit of supply: BAG 50.00 KG 9 - EXTRACT DYE BR 90000 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: 10 kg - EXTRACT DYE TRADEMARK ETHREL.BR 90000 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 5 Unit of supply: LITER 11 - CHEMICAL FERTILIZER BR 72010 SL Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: BAG 50.00 KG 12 - CHEMICAL FERTILIZER BR 72010 SL Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference : No Quantity: 5 Unit of delivery: 50.00 KG BAG 13 - CHEMICAL FERTILIZER BR 72010 SL Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 10 units supply: BAG 50.00 KG 14 - EXTRACT DYE BR 379790 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 60 Unit Supply: 15 LITER - EXTRACT DYE BR 407 604 - IMIDAN COMMERCIAL REFERENCE 500WP Differential Treatment: - Decree 7174 Applicability: Applicability No Margin Preference: No Quantity: 25 Unit Supply: 16 kg - EXTRACT DYE BR 412 305 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 20 Unit Supply: LITER 17 - EXTRACT DYE BR 420 284 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 75 Unit Supply: 18 kg - EXTRACT DYE BR 391231 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 10 units supply: 19 kg - EXTRACT DYE BR 424 087 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: 20 kg - EXTRACT DYE PEL Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 5 supply unit: 21 kg - EXTRACT DYE PEL Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 3 unit of delivery: 22 LITER - EXTRACT DYE ORANGE VEGETABLE OIL (SOURCE OF FATTY ACID ESTERS VEGETABLE) BR 388 571 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 unit of delivery: 23 LITER - EXTRACT DYE PEL

Electronic Auction - Purchase of material chemical reagents consumption for the course of Chemical Engineering.

MINISTÉRIO DA EDUCAÇÃO, Secretaria Executiva, Subsecretaria de Planejamento e Orçamento, Instituto Federal de Educação, Ciência e Tecnologia Sul-Rio-Grandense-RS, Campus Pelotas, | Published December 9, 2015

1 - ACETATO DE AMÔNIO ACETATO DE AMÔNIO, COMPOSIÇÃO BÁSICA NH4C2H3O2, ASPECTO FÍSICO CRISTAL BRANCO,PESO MOLECULAR 77,08 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 99%, CARACTERÍSTICAS ADICIONAIS REAGENTE P/HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 631-61-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 2 - ÁCIDO CLORÍDRICO ÁCIDO CLORÍDRICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR/AMARELADO, FUMEGANTE, PESO MOLECULAR 36,46 G/MOL, FÓRMULA QUÍMICA HCL, TEOR TEOR MÍNIMO DE 37%, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7647-01-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 39 Unidade de fornecimento: LITRO 3 - ÁCIDO ACÉTICO ÁCIDO ACÉTICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, PESO MOLECULAR 60,05 G/MOL, FÓRMULA QUÍMICA C2H4O2, GRAU DE PUREZA PUREZA MÍNIMA DE 99,7%, CARACTERÍSTICA ADICIONAL GLACIAL,REAGENTE P.A.-ACS-ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-19-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 17 Unidade de fornecimento: LITRO 4 - ACETONA ACETONA, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, FÓRMULA QUÍMICA C3H6O, MASSA MOLECULAR 58,08 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 67- 64-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 31 Unidade de fornecimento: LITRO 5 - DICLOROMETANO DICLOROMETANO, ASPECTO FÍSICO LÍQUIDO CLARO, INCOLOR, FÓRMULA QUÍMICA CH2CL2, MASSA MOLECULAR 84,93 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 75- 09-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 60 Unidade de fornecimento: LITRO 6 - HEXANO HEXANO, ASPECTO FÍSICO LÍQUIDO TRANSPARENTE, PESO MOLECULAR 86,18 G/MOL, COMPOSIÇÃO QUÍMICA C6H14 (MISTURA DE ISÔMEROS), TEOR DE PUREZA PUREZA MÍNIMA DE 98,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 54 Unidade de fornecimento: LITRO 7 - SÍLICA GEL SÍLICA GEL, COMPOSIÇÃO SIO2, COR BRANCA, ASPECTO FÍSICO PÓ, USO COLUNAS CROMATOGRÁFICAS, CARACTERÍSTICAS ADICIONAIS PARTÍCULA 70-230 MESH, PORO 60 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: QUILOGRAMA 8 - HIDRÓXIDO DE SÓDIO HIDRÓXIDO DE SÓDIO, ASPECTO FÍSICO EM LENTILHAS OU MICRO PÉROLAS ESBRANQUIÇADAS, PESO MOLECULAR 40 G/MOL, FÓRMULA QUÍMICA NAOH, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 1310-73-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 25 Unidade de fornecimento: QUILOGRAMA 9 - NITRATO DE PRATA NITRATO DE PRATA, ASPECTO FÍSICO CRISTAL INCOLOR, TRANSPARENTE, INODORO, FÓRMULA QUÍMICA AGNO3, PESO MOLECULAR 169,87 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7761-88-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 10 - SOLUÇÃO TAMPÃO SOLUÇÃO TAMPÃO, LEITURA PH 4,0, APLICAÇÃO CALIBRAGEM DE PEAGÂMETRO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: FRASCO 1,00 L 11 - SOLUÇÃO TAMPÃO SOLUÇÃO TAMPÃO, LEITURA PH 7,0, APLICAÇÃO CALIBRAGEM DE PEAGÂMETRO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: FRASCO 1,00 L 12 - SOLUÇÃO TAMPÃO SOLUÇÃO TAMPÃO, LEITURA PH 10, APLICAÇÃO CALIBRAGEM DE PEAGÂMETRO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: FRASCO 1,00 L 13 - ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA) ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA), ASPECTO FÍSICO PÓ BRANCO CRISTALINO, PESO MOLECULAR 372,24 G/MOL, FÓRMULA QUÍMICA C10H14N2O8NA2.2H2O (SAL DISSÓDICODIHIDRATADO), GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 6381-92-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: QUILOGRAMA 14 - PERÓXIDO DE HIDROGÊNIO PERÓXIDO DE HIDROGÊNIO, ASPECTO FÍSICO LÍQUIDO INCOLOR, INSTÁVEL, CORROSIVO, COMPOSIÇÃO BÁSICA H202, PESO MOLECULAR 34,01 G/MOL, PUREZA MÍNIMA TEOR DE 35%,CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7722-84-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15 Unidade de fornecimento: LITRO 15 - CLORETO DE AMÔNIO CLORETO DE AMÔNIO, ASPECTO FÍSICO PÓ BRANCO, CRISTALINO, INODORO, PESO MOLECULAR 53,49 G/MOL, FÓRMULA QUÍMICA NH4CL, TEOR DE PUREZA PUREZA MÍNIMA DE 99,8%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 12125-02-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: QUILOGRAMA 16 - HIDRÓXIDO DE AMÔNIO HIDRÓXIDO DE AMÔNIO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, DE ODORACRE, PESO MOLECULAR 35,05 G/MOL, FÓRMULA QUÍMICA NH4OH, GRAU DE PUREZA TEOR DE NH3 ENTRE 28 E 30%, CARACTERÍSTICA ADICIONAL EM SOLUÇÃO AQUOSA, REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 1336-21-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15 Unidade de fornecimento: LITRO 17 - CROMATO DE POTÁSSIO CROMATO DE POTÁSSIO, ASPECTO FÍSICO PÓ CRISTALINO AMARELO ALARANJADO, INODORO,FÓRMULA QUÍMICA K2CRO4 ANIDRO, MASSA MOLECULAR 194,19 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7789-00-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: QUILOGRAMA 18 - CLORETO DE SÓDIO CLORETO DE SÓDIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO OU CRISTAIS INCOLORES, COMPOSIÇÃO QUÍMICA NACL ANIDRO, PESO MOLECULAR 58,45 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL PADRÃO PRIMÁRIO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7647-14-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: QUILOGRAMA 19 - CARBONATO DE SÓDIO CARBONATO DE SÓDIO, ASPECTO FÍSICO PÓ OU CRISTAIS BRANCOS, HIGROSCÓPICOS, INODOROS, FÓRMULA QUÍMICA NA2CO3 ANIDRO, PESO MOLECULAR 105,99 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,95%, CARACTERÍSTICA ADICIONAL PADRÃO PRIMÁRIO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 497-19-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: QUILOGRAMA 20 - LÍQUIDO PENETRANTE EXTRAN PURO NEUTRO MERCK . Marca de referência Merk, similar ou superior. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 18 Unidade de fornecimento: LITRO 21 - LÍQUIDO PENETRANTE RESINA CHELEX 100 (50-100 MESH-DRY) Marca de referência SIGMA-ALDRICH qualidade similar ou superior. FRASCO COM 100G. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: UNIDADE 22 - AMPOLA PADRÃO TITRISOL CÁDMIO 100g. Marca referência MERCK qualidade similar ou superior. Ampola com 100g. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: UNIDADE 23 - AMPOLA PADRÃO TITRISOL COBALTO 100g.Marca referência MERCK qualidade similar ou superior. Ampola com 100g. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: UNIDADE 24 - AMPOLA PADRÃO TITRISOL ALUMÍNIO 100g. Marca referência MERCK qualidade similar ou superior Ampola com 100g. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: UNIDADE 25 - AMPOLA PADRÃO TITRISOL MOLIBDENIO 100g. Marca referência MERCK qualidade similar ou superior e. Ampola com 100g. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: UNIDADE 26 - LÍQUIDO PENETRANTE SOLUÇÃO ELETROLITICA PARA REPOSIÇÃO OXIÌMETRO HOMIS. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 27 - SOLUÇÃO PADRÃO SOLUÇÃO PADRÃO, TIPO CONDUTIVIDADE, CONDUTIVIDADE ELÉTRICA 84 MICROSIEMENS/CM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: FRASCO 100,00 ML 28 - CLOROFÓRMIO CLOROFÓRMIO, ASPECTO FÍSICO LÍQUIDO CLARO, INCOLOR, ODOR FORTE CARACTERÍSTICO,PESO MOLECULAR 119,38 G/MOL, FÓRMULA QUÍMICA CHCL3, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P/ UV-HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-66-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 19 Unidade de fornecimento: LITRO 29 - NITRATO DE POTÁSSIO NITRATO DE POTÁSSIO, ASPECTO FÍSICO CRISTAL BRANCO, INODORO, PESO MOLECULAR 101,10 G/MOL, FÓRMULA QUÍMICA KNO3, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7757-79-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 30 - HIDRÓXIDO DE POTÁSSIO HIDRÓXIDO DE POTÁSSIO, ASPECTO FÍSICO ESCAMA OU LENTILHA BRANCA, INODORA, HIGROSCÓPICA, PESO MOLECULAR 56,11 G/MOL, FÓRMULA QUÍMICA KOH, GRAU DE PUREZA TEOR MÍNIMO DE 85%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 1310-58-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 11500 Unidade de fornecimento: GRAMA 31 - NITRITO DE SÓDIO NITRITO DE SÓDIO, ASPECTO FÍSICO GRÂNULOS BRANCO/AMARELADOS, CRISTALINOS, INODOROS, FÓRMULA QUÍMICA NANO2, PESO MOLECULAR 68,99 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7632-00-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: QUILOGRAMA 32 - CLORETO DE POTÁSSIO CLORETO DE POTÁSSIO, ASPECTO FÍSICO PÓ OU CRISTAL BRANCO, INODORO, FÓRMULA QUÍMICA KCL, MASSA MOLECULAR 74,55 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%,CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7447-40-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: QUILOGRAMA 33 - FERROCIANETO DE POTÁSSIO FERROCIANETO DE POTÁSSIO, ASPECTO FÍSICO CRISTAL AMARELO, FÓRMULA QUÍMICA K4FE(CN)6.3H20 (TRIHIDRATADO), PESO MOLECULAR 422,39 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 14459-95-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 34 - ÁCIDO OXÁLICO ÁCIDO OXÁLICO, ASPECTO FÍSICO CRISTAL OU PÓ BRANCO CRISTALINO HIGROSCÓPICO, PESO MOLECULAR 126,07 G/MOL, FÓRMULA QUÍMICA C2H2O4.2H2O, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 6153-56-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: QUILOGRAMA 35 - MOLIBDATO DE AMÔNIO MOLIBDATO DE AMÔNIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO A LEVEMENTE AMARELADO, PESO MOLECULAR 1235,86 G/MOL, FÓRMULA QUÍMICA (NH4)6MO7O24·4H2O (HEPTAMOLIBDATO, TETRAHIDRATADO ), GRAU DE PUREZA TEOR DE MOO3 81,0 A 83,0%, PUREZA MÍNIMA DE 99,0%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERODE REFERÊNCIA QUÍMICA CAS 12054-85-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 36 - IODETO DE POTÁSSIO IODETO DE POTÁSSIO, ASPECTO FÍSICO PÓ BRANCO, CRISTALINO, INODORO, FÓRMULA QUÍMICA KI, PESO MOLECULAR 166,01 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7681-11-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 37 - TIOSSULFATO DE SÓDIO TIOSSULFATO DE SÓDIO, ASPECTO FÍSICO CRISTAL INCOLOR, INODORO, FÓRMULA QUÍMICANA2S2O3 ANIDRO, PESO MOLECULAR 158,11 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7772-98-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: QUILOGRAMA 38 - ÁCIDO ACÉTICO ÁCIDO ACÉTICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, PESO MOLECULAR 60,05 G/MOL, FÓRMULA QUÍMICA C2H4O2, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL GLACIAL, REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-19-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 22 Unidade de fornecimento: LITRO 39 - OXICLORETO DE ZIRCÔNIO OXICLORETO DE ZIRCÔNIO, COMPOSIÇÃO ZROCL2.8H2O (OCTAHIDRATADO), ASPECTO FÍSICOCRISTAL INCOLOR A BRANCO, INODORO, PESO MOLECULAR 322,25 G/MOL, GRAU DE PUREZAPUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 13520-92-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1000 Unidade de fornecimento: GRAMA 40 - FLUORETO DE SÓDIO FLUORETO DE SÓDIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO, INODORO, FÓRMULA QUÍMICA NAF, PESO MOLECULAR 41,99 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7681- 49-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 41 - PERSULFATO DE AMÔNIO PERSULFATO DE AMÔNIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO, INODORO, COMPOSIÇÃOBÁSICA (NH4)2S2O8, PESO MOLECULAR 228,20 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7727-54-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 42 - PERMANGANATO DE POTÁSSIO PERMANGANATO DE POTÁSSIO, ASPECTO FÍSICO PÓ CRISTALINO MARROM VIOLÁCEO, INODORO, FÓRMULA QUÍMICA KMNO4, PESO MOLECULAR 158,03 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7722-64-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: QUILOGRAMA 43 - CLORETO DE BÁRIO CLORETO DE BÁRIO, ASPECTO FÍSICO PÓ OU GRÂNULO CRISTALINO, INCOLOR OU BRANCO, FÓRMULA QUÍMICA BACL2.2H2O, MASSA MOLECULAR 244,27 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 10326-27-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 44 - CLOROPLATINATO DE POTÁSSIO CLOROPLATINATO DE POTÁSSIO, ASPECTO FÍSICO PÓ CRISTALINO AMARELO, INODORO, PESO MOLECULAR 486,01 G/MOL, FÓRMULA QUÍMICA K2PTCL6, GRAU DE PUREZA TEOR MÍNIMO DE PLATINA 40%, CARACTERÍSTICA ADICIONAL PRODUTO P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 16921-30-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 45 - CLORETO DE COBALTO II CLORETO DE COBALTO II, ASPECTO FÍSICO CRISTAL ROSA A VERMELHO, ODOR LEVE PENETRANTE, PESO MOLECULAR 237,93 G/MOL, FÓRMULA QUÍMICA COCL2.6H2O, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7791-13-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1000 Unidade de fornecimento: GRAMA 46 - AZIDA SÓDICA AZIDA SÓDICA, COMPOSIÇÃO QUÍMICA NAN3, PESO MOLECULAR 65,01 G/MOL, ASPECTO FÍSICO PÓ BRANCO CRISTALINO OU CRISTAL INCOLOR, INODORO, GRAU DE PUREZA PUREZAMÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 26628-22-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1005 Unidade de fornecimento: GRAMA 47 - CLORETO DE FERRO CLORETO DE FERRO, ASPECTO FÍSICO PÓ CRISTALINO, MARROM AMARELADO, COMPOSIÇÃO FECL3.6H2O, PESO MOLECULAR 270,30 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 98%, CARACTERÍSTICAS ADICIONAIS REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS10025-77-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 48 - CLORETO DE ESTANHO CLORETO DE ESTANHO, ASPECTO FÍSICO CRISTAL INCOLOR, LEVE ODOR DE CLORO, FÓRMULA QUÍMICA SNCL2.2H2O (DIHIDRATADO), PESO MOLECULAR 225,63 G/MOL, TEOR DEPUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 10025-69-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 49 - ÉTER DE PETRÓLEO ÉTER DE PETRÓLEO, ASPECTO FÍSICO LÍQUIDO INCOLOR, LÍMPIDO, COM ODOR DE GASOLINA, FÓRMULA QUÍMICA MISTURA DE HIDROCARBONETOS DERIVADOS DO PETRÓLEO, FAIXA DE DESTILAÇÃO DESTILADOS ENTRE 30¨ E 60¨C, TEOR DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICACAS 8032-32-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 17 Unidade de fornecimento: LITRO 50 - CORANTE CORANTE, ASPECTO FÍSICO PÓ, TIPO* VERMELHO DE METILA, NÚMERO DE REFERÊNCIA QUÍMICA CI 13020 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 7 Unidade de fornecimento: FRASCO 100,00 G 51 - SULFATO DE PRATA SULFATO DE PRATA, ASPECTO FÍSICO CRISTAL BRANCO, INODORO, PESO MOLECULAR 311,83 G/MOL, COMPOSIÇÃO QUÍMICA AG2SO4, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 1029426-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1200 Unidade de fornecimento: GRAMA 52 - PERSULFATO DE POTÁSSIO PERSULFATO DE POTÁSSIO, ASPECTO FÍSICO PÓ BRANCO, INODORO, FÓRMULA QUÍMICA K2S2O8, PESO MOLECULAR 270,32 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7727-21-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 53 - 1,10-FENANTROLINA (ORTO-FENANTROLINA) 1,10-FENANTROLINA (ORTO-FENANTROLINA), ASPECTO FÍSICO PÓ ESBRANQUIÇADO, CRISTALINO, ODOR FRACO, PESO MOLECULAR 198,22 G/MOL, FÓRMULA QUÍMICA C12H8N2.H20 (MONOHIDRATADA), GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 5144-89-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2030 Unidade de fornecimento: GRAMA 54 - ACETATO DE AMÔNIO ACETATO DE AMÔNIO, COMPOSIÇÃO BÁSICA NH4C2H3O2, ASPECTO FÍSICO CRISTAL BRANCO,PESO MOLECULAR 77,08 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 98%, CARACTERÍSTICAS ADICIONAIS REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 63161-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 55 - SULFETO DE SÓDIO SULFETO DE SÓDIO, ASPECTO FÍSICO CRISTAL OU FLOCO,BRANCO À AMARELADO, ODOR PODRE, PESO MOLECULAR 240,18 G/MOL, FÓRMULA QUÍMICA NA2S.9H2O (NONAHIDRATADO),GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 1313-84-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 56 - CORANTE CORANTE, TIPO ALARANJADO DE METILA, ASPECTO FÍSICO PÓ, CARACTERÍSTICAS ADICIONAIS CI 13025 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 13 Unidade de fornecimento: FRASCO 100,00 G 57 - ÁCIDO ASCÓRBICO ÁCIDO ASCÓRBICO, ASPECTO FÍSICO CRISTAL BRANCO À AMARELADO, FÓRMULA QUÍMICA C6H8O6 ( ÁCIDO L-ASCÓRBICO), PESO MOLECULAR 176,13 G/MOL, PUREZA PUREZA MÍNIMADE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 50-81-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 58 - CORANTE CORANTE, TIPO* PRETO ERIOCROMO T, CARACTERÍSTICA ADICIONAL* CI 13893, ASPECTO FÍSICO* PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 13 Unidade de fornecimento: FRASCO 100,00 G 59 - CLORETO DE SÓDIO CLORETO DE SÓDIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO OU CRISTAIS INCOLORES, COMPOSIÇÃO QUÍMICA NACL ANIDRO, PESO MOLECULAR 58,45 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERODE REFERÊNCIA QUÍMICA CAS 7647-14-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: QUILOGRAMA 60 - ACETATO DE SÓDIO ACETATO DE SÓDIO, ASPECTO FÍSICO FINO COMPOSTO DE CRISTAIS BRANCOS OU INCOLORES, FÓRMULA QUÍMICA CHACOONA.3H20, MASSA MOLECULAR 136,08 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERODE REFERÊNCIA QUÍMICA CAS 6131-90-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 61 - REAGENTE ANALÍTICO. REAGENTE ANALÍTICO., TIPO FERROÍNA, ASPECTO FÍSICO SOLUÇÃO AQUOSA, CONCENTRAÇÃO 0,025 M Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: FRASCO 100,00 ML 62 - SULFATO DE MERCÚRIO II SULFATO DE MERCÚRIO II, COMPOSIÇÃO QUÍMICA HGSO4, ASPECTO FÍSICO PÓ CRISTALINO, PESO MOLECULAR 296,65 G/MOL, GRAU DE PUREZA MÍNIMO DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7783-35-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1500 Unidade de fornecimento: GRAMA 63 - SULFATO DE PRATA SULFATO DE PRATA, ASPECTO FÍSICO CRISTAL BRANCO, INODORO, PESO MOLECULAR 311,83 G/MOL, COMPOSIÇÃO QUÍMICA AG2SO4, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 1029426-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 700 Unidade de fornecimento: GRAMA 64 - BISSULFITO DE SÓDIO BISSULFITO DE SÓDIO, ASPECTO FÍSICO PÓ BRANCO CRISTALINO, FÓRMULA QUÍMICA NAHSO3, PESO MOLECULAR 104,06 G/MOL, GRAU DE PUREZA TEOR DE (SO2) MÍNIMO DE 58,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7631-90-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 65 - ACETATO DE AMÔNIO ACETATO DE AMÔNIO, COMPOSIÇÃO BÁSICA NH4C2H3O2, ASPECTO FÍSICO CRISTAL BRANCO,PESO MOLECULAR 77,08 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 98%, CARACTERÍSTICAS ADICIONAIS REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS631-61-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 66 - PERSULFATO DE AMÔNIO PERSULFATO DE AMÔNIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO, INODORO, COMPOSIÇÃOBÁSICA (NH4)2S2O8, PESO MOLECULAR 228,20 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7727-54-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 67 - SULFATO DE MERCÚRIO II SULFATO DE MERCÚRIO II, COMPOSIÇÃO QUÍMICA HGSO4, ASPECTO FÍSICO PÓ CRISTALINO, PESO MOLECULAR 296,65 G/MOL, GRAU DE PUREZA MÍNIMO DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7783-35-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: GRAMA 68 - SULFATO DE AMÔNIO E FERRO SULFATO DE AMÔNIO E FERRO, ASPECTO FÍSICO PÓ VERDE A AZULADO, FOTOSSENSÍVEL, HIGROSCÓPICO, PESO MOLECULAR 392,14 G/MOL, FÓRMULA QUÍMICA FE(NH4)2(SO4)2·6H2O(FERRO II, HEXAHIDRATADO), GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICAADICIONAL REAGENTE P.A. ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7783-85-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 69 - SULFATO DE ALUMÍNIO SULFATO DE ALUMÍNIO, ASPECTO FÍSICO CRISTAL INCOLOR, INODORO, FÓRMULA QUÍMICA AL2(SO4)3 ANIDRO, PESO MOLECULAR 342,14 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE98%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 10043-01-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 9 Unidade de fornecimento: QUILOGRAMA 70 - ÁCIDO PERCLÓRICO ÁCIDO PERCLÓRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR OU LEVEMENTE AMARELADO, PESO MOLECULAR 100,46 G/MOL, FÓRMULA QUÍMICA HCLO4, GRAU DE PUREZA CONCENTRAÇÃO MÍNIMA DE 70%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7601-90-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 11 Unidade de fornecimento: LITRO 71 - ÁCIDO SULFÚRICO ÁCIDO SULFÚRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR, INODORO, VISCOSO, CRISTALINO,FÓRMULA QUÍMICA H2SO4, MASSA MOLECULAR 98,09 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 95%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7664-93-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 25 Unidade de fornecimento: LITRO 72 - ÁCIDO NÍTRICO ÁCIDO NÍTRICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO,INCOLOR À AMARELADO,ODOR SUFOCANT E, FÓRMULA QUÍMICA HNO3, PESO MOLECULAR 63,01 G/MOL, TEOR TEOR MÍNIMONA FAIXA ENTRE 68 E 70%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7697-37-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 35 Unidade de fornecimento: LITRO 73 - ÁCIDO CLORÍDRICO ÁCIDO CLORÍDRICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR/AMARELADO, FUMEGANTE, PESO MOLECULAR 36,46 G/MOL, FÓRMULA QUÍMICA HCL, TEOR TEOR MÍNIMO DE 37%, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7647-01-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15 Unidade de fornecimento: LITRO 74 - ÁCIDO FOSFÓRICO ÁCIDO FOSFÓRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR, INODORO, FÓRMULA QUÍMICA H3PO4, PESO MOLECULAR 98,00 G/MOL, TEOR DE PUREZA TEOR MÍNIMO DE 85%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7664-38-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 17 Unidade de fornecimento: LITRO 75 - PERÓXIDO DE HIDROGÊNIO (ÁGUA OXIGENADA) PERÓXIDO DE HIDROGÊNIO (ÁGUA OXIGENADA), CONCENTRAÇÃO 200 VOLUMES Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 13 Unidade de fornecimento: LITRO 76 - SULFETO DE SÓDIO SULFETO DE SÓDIO, ASPECTO FÍSICO CRISTAL OU FLOCO,BRANCO À AMARELADO, ODOR PODRE, PESO MOLECULAR 240,18 G/MOL, FÓRMULA QUÍMICA NA2S.9H2O (NONAHIDRATADO),GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 1313-84-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 77 - HIDRÓXIDO DE SÓDIO HIDRÓXIDO DE SÓDIO, ASPECTO FÍSICO EM LENTILHAS OU MICRO PÉROLAS ESBRANQUIÇADAS, PESO MOLECULAR 40 G/MOL, FÓRMULA QUÍMICA NAOH, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 1310-73-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 16 Unidade de fornecimento: QUILOGRAMA 78 - ÉTER DIETÍLICO ÉTER DIETÍLICO, COMPOSIÇÃO QUÍMICA (C2H5)2O, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,8%, PESO MOLECULAR 74,12 G/MOL, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 60-29-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 25 Unidade de fornecimento: LITRO 79 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, TEOR ALCOÓLICO MÍNIMO DE 99,5¨GL, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/ MOL, GRAU DE PUREZA MÍNIMO DE 99,7% P/P INPM, CARACTERÍSTICA ADICIONAL ABSOLUTO, REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-17-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 35 Unidade de fornecimento: LITRO 80 - SULFATO DE SÓDIO SULFATO DE SÓDIO, ASPECTO FÍSICO FINOS GRÂNULOS BRANCOS CRISTALINOS, INODOROS,PESO MOLECULAR 142,04 G/MOL, FÓRMULA QUÍMICA NA2.SO4 ANIDRO, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7757-82-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 12 Unidade de fornecimento: QUILOGRAMA 81 - SULFATO DE POTÁSSIO SULFATO DE POTÁSSIO, PESO MOLECULAR 174,26 G/MOL, ASPECTO FÍSICO CRISTAIS BRANCOS, INODOROS, FÓRMULA QUÍMICA K2SO4, GRAU DE PUREZA PUREZA MÍNIMA DE 99%,CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7778-80-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 82 - REAGENTE ANALÍTICO. REAGENTE ANALÍTICO., TIPO FERROÍNA, ASPECTO FÍSICO SOLUÇÃO AQUOSA, CONCENTRAÇÃO 0,025 M Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 1,00 L 83 - DICROMATO DE POTÁSSIO DICROMATO DE POTÁSSIO, ASPECTO FÍSICO PÓ FINO, CRISTALINO, COR LARANJA, COMPOSIÇÃO QUÍMICA K2CR2O7, PESO MOLECULAR 294,18 G/MOL, GRAU DE PUREZA PUREZAMÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7778-50-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15 Unidade de fornecimento: QUILOGRAMA 84 - SULFATO DE PRATA SULFATO DE PRATA, ASPECTO FÍSICO CRISTAL BRANCO, INODORO, PESO MOLECULAR 311,83 G/MOL, COMPOSIÇÃO QUÍMICA AG2SO4, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 10294-26-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 300 Unidade de fornecimento: GRAMA 85 - MEDIDOR LABORATÓRIO Fitas para medir pH de 0 a 14, medição de 1 em 1 pH Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4800 Unidade de fornecimento: UNIDADE 86 - CORANTE CORANTE, TIPO AZUL DE BROMOTIMOL, ASPECTO FÍSICO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: FRASCO 500,00 G 87 - SOLUÇÃO TAMPÃO SOLUÇÃO TAMPÃO, LEITURA PH 4,0, APLICAÇÃO CALIBRAGEM DE PEAGÂMETRO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: FRASCO 1,00 L 88 - SOLUÇÃO TAMPÃO SOLUÇÃO TAMPÃO, LEITURA PH 7,0, APLICAÇÃO CALIBRAGEM DE PEAGÂMETRO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: FRASCO 1,00 L 89 - SOLUÇÃO TAMPÃO SOLUÇÃO TAMPÃO, LEITURA PH 10, APLICAÇÃO CALIBRAGEM DE PEAGÂMETRO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: FRASCO 1,00 L 90 - CARBONATO DE CÁLCIO CARBONATO DE CÁLCIO, ASPECTO FÍSICO PRECIPITADO,PÓ BRANCO, FINO, INODORO, HIGROSCÓPIC O, PESO MOLECULAR 100,09 G/MOL, FÓRMULA QUÍMICA CACO3, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERISTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 471-34-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: QUILOGRAMA 91 - CLORETO DE CÁLCIO CLORETO DE CÁLCIO, ASPECTO FÍSICO CRISTAL HIGROSCÓPICO, INCOLOR , INODORO, FÓRMULA QUÍMICA CACL2 ANIDRO, MASSA MOLECULAR 110,99 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 95%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 10043-52-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 92 - SULFATO DE MAGNÉSIO SULFATO DE MAGNÉSIO, ASPECTO FÍSICO CRISTAL INCOLOR, BRILHANTE, INODORO, AMARGO, FÓRMULA QUÍMICA MGSO4 ANIDRO, MASSA MOLECULAR 120,39 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DEREFERÊNCIA QUÍMICA CAS 7487-88-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 93 - SULFATO DE POTÁSSIO SULFATO DE POTÁSSIO, PESO MOLECULAR 174,26 G/MOL, ASPECTO FÍSICO CRISTAIS BRANCOS, INODOROS, FÓRMULA QUÍMICA K2SO4, GRAU DE PUREZA PUREZA MÍNIMA DE 99%,CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7778-80-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 94 - MERCÚRIO MERCÚRIO, ASPECTO FÍSICO METAL LÍQUIDO, PESADO, COR BRANCA BRATEADA, FÓRMULA QUÍMICA HG, PESO MOLECULAR 200,59 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7439-97-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 95 - SULFATO DE COBRE II SULFATO DE COBRE II, COMPOSIÇÃO QUÍMICA CUSO4 ANIDRO, ASPECTO FÍSICO FINO CRISTAL BRANCO, PESO DA MOLÉCULA 159,60 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7758-98-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2000 Unidade de fornecimento: GRAMA 96 - SULFATO DE ZINCO SULFATO DE ZINCO, ASPECTO FÍSICO PÓ OU CRISTAL, INCOLOR OU BRANCO, FÓRMULA QUÍMICA ZNSO4.7H2O, MASSA MOLECULAR 287,60 G/MOL, GRAU DE PUREZA PUREZA MÍNIMADE 99%, CARACTERÍSTICA ADICIONAL REAGENTE ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7446-20-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1500 Unidade de fornecimento: GRAMA 97 - BROMATO DE POTÁSSIO BROMATO DE POTÁSSIO, ASPECTO FÍSICO PÓ OU CRISTAIS BRANCOS, INODOROS, FÓRMULA QUÍMICA KBRO3, PESO MOLECULAR 167,00 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,8%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7758-01-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1700 Unidade de fornecimento: GRAMA 98 - REAGENTE ANALÍTICO REAGENTE ANALÍTICO, ASPECTO FÍSICO PÓ, COMPOSIÇÃO ÁCIDO CALCONCARBOXÍLICO, CARACTERÍSTICAS ADICIONAIS CAS 3737-95-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: FRASCO 100,00 G 99 - DIFENILAMINA DIFENILAMINA, ASPECTO FÍSICO PÓ BRANCO A ACASTANHADO, FÓRMULA QUÍMICA (C6H5)2NH, PESO MOLECULAR 169,22 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P/ SÍNTESE, NÚMERO DE REFERÊNCIA QUÍMICA CAS122-39-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 300 Unidade de fornecimento: GRAMA 100 - FENOLFTALEÍNA FENOLFTALEÍNA, COMPOSIÇÃO C20H1404, PESO MOLECULAR 318,33 G/MOL, ASPECTO FÍSICO CRISTAL BRANCO A LEVEMENTE AMARELADO, CARACTERÍSTICA ADICIONAL REAGENTEP.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 77-09-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1700 Unidade de fornecimento: GRAMA

Electronic Auction - Laboratory chemical material acquisition

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO, Empresa Brasileira de Pesquisa Agropecuária, Embrapa/CPACT, | Published June 28, 2016

1 - ACETATO DE ETILA ACETATO DE ETILA, ASPECTO FÍSICO LÍQUIDO INCOLOR, LÍMPIDO, INFLAMÁVEL, PUREZA MÍNIMA PUREZA MÍNIMA DE 99%, COMPOSIÇÃO QUÍMICA CH3CO2C2H5, PESO MOLECULAR 88,1 G/MOL, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 141-78-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 2 - ÁCIDO ACÉTICO ÁCIDO ACÉTICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, PESO MOLECULAR 60,05 G/MOL, FÓRMULA QUÍMICA C2H4O2, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL GLACIAL,REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-19-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 3 - ÁCIDO CLORÍDRICO ÁCIDO CLORÍDRICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR/AMARELADO, FUMEGANTE, PESO MOLECULAR 36,46 G/MOL, FÓRMULA QUÍMICA HCL, TEOR TEOR MÍNIMO DE 37%, CARACTERÍSTICA ADICIONAL REAGENTE ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7647-01-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 4 - ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA) ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA), ASPECTO FÍSICO PÓ BRANCO CRISTALINO, PESO MOLECULAR 372,24 G/MOL, FÓRMULA QUÍMICA C10H14N2O8NA2.2H2O (SAL DISSÓDICODIHIDRATADO), GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 6381-92-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 5 - ÁCIDO FÓRMICO ÁCIDO FÓRMICO, ASPECTO FÍSICO LÍQUIDO INCOLOR, ODOR PENETRANTE, COMPOSIÇÃO QUÍMICA HCOOH, PESO MOLECULAR 46,03 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P/ HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-18-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 6 - ÁCIDO SULFÚRICO ÁCIDO SULFÚRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR, FUMEGANTE, VISCOSO, CRISTALINO, FÓRMULA QUÍMICA H2SO4, MASSA MOLECULAR 98,09 G/MOL, GRAU DE PUREZAPUREZA MÍNIMA DE 99,99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7664-93-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 7 - ÁCIDO TÂNICO ÁCIDO TÂNICO, ASPECTO FÍSICO PÓ MARROM AMARELADO, FÓRMULA QUÍMICA C76H52O46, PESO MOLECULAR 1701,22 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1401-55-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 8 - ÁGAR ÁGAR, TIPO ÁGAR ÁGAR, ASPECTO FÍSICO PÓ, CARACTERÍSTICA ADICIONAL PURO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15 Unidade de fornecimento: FRASCO 500,00 G 9 - ÁGUA DESTILADA ÁGUA DESTILADA, ASPECTO FÍSICO ESTÉRIL E APIROGÊNICA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 32 Unidade de fornecimento: FRASCO 1.000,00 ML 10 - ÁLCOOL ETÍLICO LIMPEZA DE AMBIENTES ÁLCOOL ETÍLICO LIMPEZA DE AMBIENTES, TIPO ETÍLICO HIDRATADO, APLICAÇÃO LIMPEZA, CONCENTRAÇÃO 92,8¨INPM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 280 Unidade de fornecimento: LITRO 11 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/MOL, GRAU DE PUREZA MÍNIMO DE 95% P/P INPM, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS64-17-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 12 - BICARBONATO DE SÓDIO BICARBONATO DE SÓDIO, ASPECTO FÍSICO PÓ FINO CRISTALINO, BRANCO, INODORO, COMPOSIÇÃO NAHCO3, PUREZA MÍNIMA PUREZA MÍNIMA DE 98%, PESO MOLECULAR 84,01 G/MOL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 144-55-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 13 - CARBONATO DE CÁLCIO CARBONATO DE CÁLCIO, ASPECTO FÍSICO PRECIPITADO,PÓ BRANCO, FINO, INODORO, HIGROSCÓPIC O, PESO MOLECULAR 100,09 G/MOL, FÓRMULA QUÍMICA CACO3, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERISTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 471-34-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 250 Unidade de fornecimento: GRAMA 14 - CARBONATO DE SÓDIO CARBONATO DE SÓDIO, ASPECTO FÍSICO PÓ OU CRISTAIS BRANCOS, HIGROSCÓPICOS, INODOROS, FÓRMULA QUÍMICA NA2CO3 ANIDRO, PESO MOLECULAR 105,99 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 497-19-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 15 - CARBOXIMETILCELULOSE (CMC) CARBOXIMETILCELULOSE (CMC), ASPECTO FÍSICO PÓ BRANCO OU LEVEMENTE AMARELADO, INODORO, FÓRMULA QUÍMICA [C6H7O2(OH)2OCH2COONA]N (SAL SÓDICO), PESO MOLECULAR (242)N G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL ALTA VISCOSIDADE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 9004-32-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 16 - CLORETO DE POTÁSSIO CLORETO DE POTÁSSIO, ASPECTO FÍSICO PÓ OU CRISTAL BRANCO, INODORO, FÓRMULA QUÍMICA KCL, MASSA MOLECULAR 74,55 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%,CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7447-40-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 12 Unidade de fornecimento: QUILOGRAMA 17 - CLORETO DE SÓDIO CLORETO DE SÓDIO, PRINCÍPIO ATIVO 0,9%_ SOLUÇÃO INJETÁVEL, APLICAÇÃO SISTEMA FECHADO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 32 Unidade de fornecimento: FRASCO 1.000,00 ML 18 - DETERGENTE DETERGENTE - USO HOSPITALAR / LABORATORIAL, ASPECTO FÍSICO LÍQUIDO, TIPO NEUTRO, COMPOSIÇÃO TENSOATIVO ANIÔNICO, EXTRAN MA02 NEUTRO, GALÃO COM 5 LITROS, MERCK Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: GALÃO 19 - DETERGENTE DETERGENTE, COMPOSIÇÃO HIDRÓXIDO SÓDIO, HIPIPOCLORITO SÓDIO, DISPERSANTE, COMPONENTE ATIVO ALCALINO CLORADO, APLICAÇÃO MÁQUINA LAVAR LOUÇA, CARACTERÍSTICAS ADICIONAIS SOLUÇÃO DE 0,2 A 0,6%, ALTO PODER DESENGORDURANTE, ASPECTO FÍSICO LÍQUIDO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: EMBALAGEM 5,00 L 20 - DICLOROMETANO DICLOROMETANO, ASPECTO FÍSICO LÍQUIDO CLARO, INCOLOR, FÓRMULA QUÍMICA CH2CL2, MASSA MOLECULAR 84,93 G/MOL, GRAU DE PUREZA PUREZA MíNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 75-09-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 21 - EXTRATO CORANTE F.A.M.E C8-C24 MIX, MISTURA DE COMPOSTOS DE CARBONOS COMPREEN DIDOS ENTRE 8 E 24 ÁTOMOS DE CARBONO, UTILIZADO COMO PADRÃO EM CROMATOGRAFIA PARA IDENTIFICAÇÃO DE COMPOSTOS QUÍMICOS, FRASCO COM 100MG, MARCA SIGMA 18918 SULPECO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 22 - FORMALDEÍDO (FORMOL) FORMALDEÍDO (FORMOL), ASPECTO FÍSICO LÍQUIDO INCOLOR, LÍMPIDO, FÓRMULA QUÍMICAH2CO, PESO MOLECULAR 30,03 G/MOL, GRAU DE PUREZA CONCENTRAÇÃO ENTRE 37 E 40%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 50-00-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 23 - CONJUNTO PARA ANÁLISE CONJUNTO PARA ANÁLISE, COMPOSIÇÃO BÁSICA MISTURA PARA REAÇÃO, APLICAÇÃO PARA PCR, COMPONENTES TAQ DNA POLIMERASE RECOMBINANTE, DNTPS, MGCL2, OUTROS COMPONENTES SOLUÇÕES TAMPÃO, 1X Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 24 - HEXAMETAFOSFATO SÓDIO (SHMP) HEXAMETAFOSFATO SÓDIO (SHMP), COMPOSIÇÃO QUÍMICA (NAPO3)N ANIDRO, ASPECTO FÍSICO PÓ OU CRISTAL BESBRANQUIÇADO, INODORO,HIGROSCÓPIC O, PESO MOLECULAR (N)101,96 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONALREAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 10124-56-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 25 - HEXANO HEXANO, ASPECTO FÍSICO LÍQUIDO TRANSPARENTE, PESO MOLECULAR 86,18 G/MOL, COMPOSIÇÃO QUÍMICA C6H14 (N-HEXANO), TEOR DE PUREZA PUREZA MÍNIMA DE 95%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 110- 54-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 26 - HIDRÓXIDO DE POTÁSSIO HIDRÓXIDO DE POTÁSSIO, ASPECTO FÍSICO ESCAMA OU LENTILHA BRANCA, INODORA, HIGROSCÓPICA, PESO MOLECULAR 56,11 G/MOL, FÓRMULA QUÍMICA KOH, GRAU DE PUREZA TEOR MÍNIMO DE 85%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 1310-58-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 27 - IODO IODO, ASPECTO FÍSICO CRISTAL PRETO AZULADO, DE BRILHO METÁLICO, PESO MOLECULAR253,81 G/MOL, COMPOSIÇÃO QUÍMICA I2, TEOR DE PUREZA PUREZA MÍNIMA DE 99,8%, CARACTERÍSTICA ADICIONAL RESSUBLIMADO, REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7553-56-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 250 Unidade de fornecimento: GRAMA 28 - EXTRATO CORANTE KIT DE EXTRAÇÃO DE DNA INVISORB SPIN PLANT MINI (250 AMOSTRAS Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: kit 29 - NITRATO DE POTÁSSIO NITRATO DE POTÁSSIO, ASPECTO FÍSICO CRISTAL BRANCO, INODORO, PESO MOLECULAR 101,10 G/MOL, FÓRMULA QUÍMICA KNO3, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7757-79-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 30 - EXTRATO CORANTE PADRÃO DE CONDUTIVIDADE 1422US/CM A 25ºC (DIGIMED), FRASCO COM 100 ML Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: FRASCOS 31 - EXTRATO CORANTE PLANT PRESERVATIVE MEXTURE (PPM), FRASCO COM 250 ML Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 32 - EXTRATO CORANTE POLIETILENOGLICOL 6000 P.A. (PEG 6000), FRASCO COM 5 KG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: FRASCOS DE 5KG 33 - ACESSÓRIOS PARA ESTUDO/TREINAMENTO PRIMERS 16S 1492R 5 GGTTACCTTGTTACGACTT 3 . MARCA INVITROGEM BR 196910 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: KIT 34 - ACESSÓRIOS PARA ESTUDO/TREINAMENTO PRIMERS 16S 27F 5 AGAGTTTGATCCTGGCTCAG 3 . MARCA INVITROGEM BR 196910 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: KIT 35 - ACESSÓRIOS PARA ESTUDO/TREINAMENTO PROMEGATM WIZARDTM SV GEL AND PCR CLEANUP SYSTEM N.CAT#A9282(PROMEGA). BR 196910 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 36 - RESORCINOL (BENZENO-1,3-DIOL) RESORCINOL (BENZENO-1,3-DIOL), ASPECTO FÍSICO PÓ BRANCO, CRISTALINO, ODOR CARACTERÍSTICO, FÓRMULA QUÍMICA C6H6O2, PESO MOLECULAR 110,11 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P/ HPLC, NÚMERODE REFERÊNCIA QUÍMICA CAS 108-46-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 37 - SACAROSE SACAROSE, COMPOSIÇÃO QUÍMICA C12H22O11, PESO MOLECULAR 342,29 G/MOL, ASPECTO FÍSICO PÓ BRANCO CRISTALINO, INODORO, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P/ HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 5750-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 38 - SÍLICA GEL SÍLICA GEL, COMPOSIÇÃO SIO2, COR AZUL, ASPECTO FÍSICO GRANULADO, APLICAÇÃO DESUMIDIFICAR E DESIDRATAR GASES, CARACTERÍSTICAS ADICIONAIS INDICADOR DE UMIDADE, TAMANHO GRÃO 4 A 8 MM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 39 - SÍLICA GEL SÍLICA GEL, COMPOSIÇÃO SIO2, COR AZUL, CARACTERÍSTICAS ADICIONAIS NÚMERO CAS: 112926-00-8, MASSA MOLECULAR 60,8 G/MOL, GRANULOMETRIA 2-4 MM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 40 - SOLUÇÃO PADRÃO SOLUÇÃO PADRÃO, TIPO CONDUTIVIDADE, CONDUTIVIDADE ELÉTRICA APROXIMADAMENTE 12,9 MILISIEMENS/CM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 250,00 ML 41 - SOLUÇÃO TAMPÃO SOLUÇÃO TAMPÃO, LEITURA PH 10, APLICAÇÃO CALIBRAGEM DE PEAGÂMETRO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 1.000,00 ML 42 - SOLUÇÃO TAMPÃO SOLUÇÃO TAMPÃO, LEITURA PH 4,0, APLICAÇÃO CALIBRAGEM DE PEAGÂMETRO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 1.000,00 ML 43 - SOLUÇÃO TAMPÃO SOLUÇÃO TAMPÃO, LEITURA PH 7,0, APLICAÇÃO CALIBRAGEM DE PEAGÂMETRO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 1.000,00 ML 44 - TUNGSTATO TUNGSTATO, COMPOSIÇÃO QUÍMICA NA2WO4.2H2O (DISSÓDICO DIHIDRATADO), ASPECTO FÍSICO FLOCOS BRANCOS, INODOROS, PESO MOLECULAR 329,86 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 10213-10-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 45 - EXTRATO CORANTE WIZARD GENOMIC DNA PURIFICATION KIT, PROMEGA 100RX 300UL, CÓDIGO A1120 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: KIT

Electronic Auction - Laboratory Chemical Material Acquisition

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO, Empresa Brasileira de Pesquisa Agropecuária, Embrapa/CPACT, | Published May 3, 2016

1 - EXTRATO CORANTE 17 BETA ESTRADIOL (COMO REFERÊNCIA SIGRMA E-2257), FRASCO COM 1 MG. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 2 - ACETONA ACETONA, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, FÓRMULA QUÍMICA C3H6O, MASSA MOLECULAR 58,08 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 67- 64-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 3 - ACETONA ACETONA, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, FÓRMULA QUÍMICA C3H6O, MASSA MOLECULAR 58,08 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,8%, CARACTERÍSTICA ADICIONAL REAGENTE P/ UV-IR-HPLC-GPC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-64-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 4 - ÁCIDO 3,5-DINITROSALICÍLICO ÁCIDO 3,5-DINITROSALICÍLICO, ASPECTO FÍSICO PÓ BRANCO À AMARELO ESVERDEADO, INODORO, PESO MOLECULAR 228,12 G/MOL, FÓRMULA QUÍMICA C7H4N2O7, GRAU DE PUREZAPUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 609-99-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 5 - ÁCIDO ACÉTICO ÁCIDO ACÉTICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, PESO MOLECULAR 60,05 G/MOL, FÓRMULA QUÍMICA C2H4O2, GRAU DE PUREZA PUREZA MÍNIMA DE 99,7%, CARACTERÍSTICA ADICIONAL GLACIAL,REAGENTE P.A.-ACS-ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-19-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: LITRO 6 - ÁCIDO ASCÓRBICO ÁCIDO ASCÓRBICO, ASPECTO FÍSICO CRISTAL BRANCO À AMARELADO, FÓRMULA QUÍMICA C6H8O6 ( ÁCIDO L-ASCÓRBICO), PESO MOLECULAR 176,13 G/MOL, PUREZA PUREZA MÍNIMADE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 50-81-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 7 - ÁCIDO BÓRICO ÁCIDO BÓRICO, ASPECTO FÍSICO CRISTAL INCOLOR OU PÓ/GRÂNULO BRANCO, INODORO, PESO MOLECULAR 61,83 G/MOL, COMPOSIÇÃO QUÍMICA H3BO3, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 10043-35-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 8 - ÁCIDO CÍTRICO ÁCIDO CÍTRICO, ASPECTO FÍSICO CRISTAL INCOLOR, INODORO, SABOR ÁCIDO AGRADÁVEL,FÓRMULA QUÍMICA C6H8O7.H20, PESO MOLECULAR 210,14 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA* CAS 5949-29-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 9 - ÁCIDO CLORÍDRICO ÁCIDO CLORÍDRICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR/AMARELADO, FUMEGANTE, PESO MOLECULAR 36,46 G/MOL, FÓRMULA QUÍMICA HCL, TEOR TEOR MÍNIMO DE 37%, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7647-01-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 47 Unidade de fornecimento: LITRO 10 - ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA) ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA), ASPECTO FÍSICO PÓ AMARELO, INODORO, PESO MOLECULAR 367,05 G/MOL, FÓRMULA QUÍMICA C10H12N2FENAO8 (EDETATO DE FERRO III E SÓDIO), GRAU DE PUREZA TEOR MÍNIMO DE FERRO 12%, CARACTERÍSTICA ADICIONAL REAGENTE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1578-42-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 11 - ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA) ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA), ASPECTO FÍSICO PÓ BRANCO CRISTALINO, PESO MOLECULAR 372,24 G/MOL, FÓRMULA QUÍMICA C10H14N2O8NA2.2H2O (SAL DISSÓDICODIHIDRATADO), GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 6381-92-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 12 - ÁCIDO INDOL-3-BUTÍRICO ÁCIDO INDOL-3-BUTÍRICO, ASPECTO FÍSICO CRISTAL INCOLOR À LEVEMENTE ESBRANQUIÇADO, INODOR O, FÓRMULA QUÍMICA C12H13NO2, PESO MOLECULAR 203,24 G/ MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 133-32-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 5,00 G 13 - ÁCIDO INDOLACÉTICO ÁCIDO INDOLACÉTICO, FÓRMULA QUÍMICA C10H9NO2 (ÁCIDO 3-INDOLACÉTICO), ASPECTO FÍSICO* CRISTAIS ESBRANQUIÇADOS, MASSA MOLECULAR 175,19 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL TESTADO EM CULTURA DE CÉLULAS VEGETAIS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 87-51-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 25 Unidade de fornecimento: GRAMA 14 - ÁCIDO MÁLICO ÁCIDO MÁLICO, ASPECTO FÍSICO PÓ OU GRÂNULO CRISTALINO, ESBRANQUIÇADO, INODORO,FÓRMULA QUÍMICA C4H6O5 (ÁCIDO DL-MÁLICO), PESO MOLECULAR 134,09 G/MOL, GRAU DEPUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 617-48-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: GRAMA 15 - ÁCIDO NÍTRICO ÁCIDO NÍTRICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO,INCOLOR À AMARELADO,ODOR SUFOCANT E, FÓRMULA QUÍMICA HNO3, PESO MOLECULAR 63,01 G/MOL, GRAU DE PUREZA TEOR MÍNIMO DE 65%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7697-37-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 7 Unidade de fornecimento: LITRO 16 - ÁCIDO PERCLÓRICO ÁCIDO PERCLÓRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR OU LEVEMENTE AMARELADO, PESO MOLECULAR 100,46 G/MOL, FÓRMULA QUÍMICA HCLO4, GRAU DE PUREZA CONCENTRAÇÃO MÍNIMA DE 70%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7601-90-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 17 - ÁCIDO SULFÚRICO ÁCIDO SULFÚRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR, FUMEGANTE, VISCOSO, CRISTALINO, FÓRMULA QUÍMICA H2SO4, MASSA MOLECULAR 98,09 G/MOL, GRAU DE PUREZAPUREZA MÍNIMA DE 99,99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7664-93-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: LITRO 18 - ÁGAR ÁGAR, TIPO ÁGAR ÁGAR, ASPECTO FÍSICO PÓ, CARACTERÍSTICA ADICIONAL PURO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: FRASCO 500,00 G 19 - SISTEMA ESTERILIZACAO - MEIO CULTURA ÁGAR TIPO ÁGAR BACTERIOLOGICO ASPECTO FÍSICO PÓ, FRASCO COM 500 GRAMAS MARCA VETEC, SIGMA OU MELHOR QUALIDADE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: FRASCOS 20 - ÁGUA DESTILADA ÁGUA DESTILADA, ASPECTO FÍSICO ESTÉRIL E APIROGÊNICA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 32 Unidade de fornecimento: FRASCO 1.000,00 ML 21 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, TEOR ALCOÓLICO MÍNIMO DE 95 ¨GL (95% V/V) A 20 ¨C, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/MOL, CARACTERÍSTICA ADICIONAL HIDRATADO, REAGENTE P/ ESPECTROSCOPIA UV E HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-17-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: LITRO 22 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, TEOR ALCOÓLICO 95,1 A 96¨GL, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/MOL, GRAU DE PUREZA 92,6% A 93,8% P/P INPM, CARACTERÍSTICA ADICIONAL HIDRATADO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-17-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15 Unidade de fornecimento: LITRO 23 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, TEOR ALCOÓLICO MÍNIMO DE 99,5¨GL, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/ MOL, GRAU DE PUREZA MÍNIMO DE 99,7% P/P INPM, CARACTERÍSTICA ADICIONAL ANIDRO,ABSOLUTO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-17-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: LITRO 24 - ÁLCOOL METÍLICO ÁLCOOL METÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO,FÓRMULA QUÍMICA CH3OH, PESO MOLECULAR 32,04 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P/ UV/HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-56-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: LITRO 25 - ÁLCOOL PROPÍLICO ÁLCOOL PROPÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO, FÓRMULA QUÍMICA (CH3)2CHOH (ISOPROPÍLICO OU ISO-PROPANOL), PESO MOLECULAR* 60,10 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,7%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-63-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: LITRO 26 - ÁLCOOL PROPÍLICO ÁLCOOL PROPÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO, FÓRMULA QUÍMICA (CH3)2CHOH (ISOPROPÍLICO OU ISO-PROPANOL), PESO MOLECULAR* 60,10 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. LIVRE DE DNASE E RNASE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-63- 0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: LITRO 27 - ALFA-NAFTIL ALFA-NAFTIL, ASPECTO FÍSICO PÓ BRANCO OU ESBRANQUIÇADO, FÓRMULA QUÍMICA CH3CO2C10H7 (1-NAFTIL ACETATO), MASSA MOLECULAR 186,21 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 830-81-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 25 Unidade de fornecimento: GRAMA 28 - AMIDO AMIDO, ASPECTO FÍSICO PÓ FINO BRANCO A ESBRANQUIÇADO, INODORO, FÓRMULA QUÍMICA(C6H10O5)N, GRAU DE PUREZA TEOR MÁXIMO DE 0,7% DE MALTOSE (AÇÚCAR REDUTOR), CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 9005-84-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 29 - EXTRATO CORANTE ANTIBIOGRA PRINCÍPIO ATIVO PENICILINA G1OU, FRASCO COM 50 DISCOS, MARCA LABORCLIN OU MELHOR QUALIDADE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 30 - EXTRATO CORANTE ANTIBIOGRAMA PRINCÍPIO ATIVO SULFAZOTRIN 25 MCG, FRASCO COM 50 DISCOS, MARCA LABORCLIN OU MELHOR QUALIDADE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 31 - EXTRATO CORANTE ANTIBIOGRAMA, PRINCÍPIO ATIVO AMICACINA, DOSAGEM 30 MCG, FRASCO COM 50 DISCOS - MARCA LABORCLIN OU MELHOR QUALIDADE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 32 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO AMOXICILINA E ÁCIDO CLAVULÂNICO, DOSAGEM 20 + 10MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 33 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO ESTREPTOMICINA, DOSAGEM 10 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 34 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO GENTAMICINA, DOSAGEM 10 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 35 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO NEOMICINA, DOSAGEM 30 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 36 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO POLIMIXINA B, DOSAGEM 300 UI Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 37 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO TETRACICLINA, DOSAGEM 30 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 38 - ANTIBIOGRAMA. ANTIBIOGRAMA., PRINCÍPIO ATIVO CEFTIOFUR, DOSAGEM 30 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 39 - ANTIBIOGRAMA. ANTIBIOGRAMA., PRINCÍPIO ATIVO ENROFLOXACINO, DOSAGEM 5 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 40 - EXTRATO CORANTE B-NICOTINAMIDE ADENINE DINUCLEOTIDE, REDUCED DISODIUM SALT HYDRATE, FRASCO COM 1 GRAMA, MARCA SIGMA N6006-1G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 41 - BIFTALATO DE POTÁSSIO BIFTALATO DE POTÁSSIO, ASPECTO FÍSICO PÓ OU CRISTAL BRANCO OU INCOLOR, INODORO, PESO MOLECULAR 204,23 G/MOL, FÓRMULA QUÍMICA HOOC-C6H4COOK, GRAU DE PUREZA PUREZA MÍNIMA DE 99,95%, CARACTERÍSTICA ADICIONAL REAGENTE PADRÃO PRIMÁRIO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 877-24-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 42 - N,N´-METILENOBIS(ACRILAMIDA) N,N´-METILENOBIS(ACRILAMIDA), ASPECTO FÍSICO FINOS CRISTAIS BRANCOS, INODOROS,FÓRMULA QUÍMICA C7H12N2O2, PESO MOLECULAR 154,19 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 110-26-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: GRAMA 43 - EXTRATO CORANTE CALDO DETECÇÃO SELETIVA COLIFORMES TOTAIS E ESCHERICHIA COLI COM SUBSTRATO CROMOGÊNIO-FLUORESCENTE, FRASCO COM 500 GRAMAS, REF. CALDO HICOLIFORME FRASCO COM 500 GRAMAS BR 408984 MARCA HIMEDIA OU MELHOR QUALIDADE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 44 - EXTRATO CORANTE CÂNFORA EM PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: KG 45 - CARBONATO DE SÓDIO CARBONATO DE SÓDIO, ASPECTO FÍSICO PÓ OU CRISTAIS BRANCOS, HIGROSCÓPICOS, INODOROS, FÓRMULA QUÍMICA NA2CO3 ANIDRO, PESO MOLECULAR 105,99 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,95%, CARACTERÍSTICA ADICIONAL PADRÃO PRIMÁRIO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 497-19-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 46 - CARVÃO ATIVADO CARVÃO ATIVADO, ASPECTO FÍSICO GRÂNULO PRETO, INODORO, PESO MOLECULAR 12,01 G/MOL, FÓRMULA QUÍMICA C, GRAU DE PUREZA PUREZA MÍNIMA DE 90%, CARACTERÍSTICA ADICIONAL GRANULOMETRIA ESPECÍFICA, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7440-44- 0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 47 - CARVÃO MINERAL CARVÃO ATIVADO, ASPECTO FÍSICO GRÂNULO PRETO, INODORO, PESO MOLECULAR 12,01, FÓRMULA QUÍMICA C, GRAU DE PUREZA MÍNIMA DE 90, CARACTERÍSTICA ADICIONAL GRANULOMETRIA ESPECÍFICA, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7440-44-0, (3-7MM DIÂMETRO DAS PARTÍCULAS) - BR 348074 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: KG 48 - CASEÍNA CASEÍNA, FÓRMULA QUÍMICA HIDROLISADO ÁCIDO DE CASEÍNA, ASPECTO FÍSICO* PÓ AMARELO CLARO, NÚMERO DE REGISTRO QUÍMICO CAS 91079-40-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 49 - EXTRATO CORANTE CATECOL P.A. PUREZA 99%. NÚMERO CAS 120.80-9. FÓRMULA C6H4-1-2-(OH)2. PESO MOLECULAR 110.11., FRASCO COM 100 GRAMAS MARCA VETEC, SIGMA OU MELHOR QUALIDADE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 50 - SISTEMA ESTERILIZACAO - MEIO CULTURA CHROMEAZUROL S FÓRMULA C23H13CL2NA3O9S PESO MOLECULAR 605.28 G MOL (AZUL DE CROMAZUROL).MARCA SIGMA. FRASCO 25GR. BR 119792 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 51 - CICLOHEXANO CICLOHEXANO, ASPECTO FÍSICO LÍQUIDO CLARO, INCOLOR, ODOR CARACTERÍSTICO, PESO MOLECULAR 84,16 G/MOL, FÓRMULA QUÍMICA C6H12, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 110-82-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: LITRO 52 - CLORETO DE FERRO CLORETO DE FERRO, ASPECTO FÍSICO PÓ CRISTALINO ESVERDEADO AMARELADO, COMPOSIÇÃO FECL3 (COMPOSTO ANIDRO), PESO MOLECULAR 162,21 G/MOL, PUREZA MÍNIMAPUREZA MÍNIMA DE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7705-08-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 250 Unidade de fornecimento: GRAMA 53 - CLORETO DE POTÁSSIO CLORETO DE POTÁSSIO, ASPECTO FÍSICO PÓ OU CRISTAL BRANCO, INODORO, FÓRMULA QUÍMICA KCL, MASSA MOLECULAR 74,55 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%,CARACTERÍSTICA ADICIONAL REAGENTE ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7447- 40-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: QUILOGRAMA 54 - CLORETO DE POTÁSSIO CLORETO DE POTÁSSIO, ASPECTO FÍSICO PÓ OU CRISTAL BRANCO, INODORO, FÓRMULA QUÍMICA KCL, MASSA MOLECULAR 74,55 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%,CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7447-40-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2500 Unidade de fornecimento: GRAMA 55 - CLOROFÓRMIO CLOROFÓRMIO, ASPECTO FÍSICO LÍQUIDO CLARO, INCOLOR, ODOR FORTE CARACTERÍSTICO,PESO MOLECULAR 119,38 G/MOL, FÓRMULA QUÍMICA CHCL3, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P/ UV-HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-66-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: LITRO 56 - CORANTE CORANTE, TIPO IODETO DE PROPÍDEO, ASPECTO FÍSICO PÓ, NÚMERO DE REFERÊNCIA QUÍMICA CAS 25535-16-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 10,00 MG 57 - SISTEMA ESTERILIZACAO - MEIO CULTURA CORN MEAL AGAR FOR MICROBIOLOGY. FRASCO 500 GRAMAS. MARCA DE REFERÊNCIA BR 119792 MARCA SIGMA CÓD. 42347-500G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 58 - DETERGENTE DETERGENTE - USO HOSPITALAR / LABORATORIAL, ASPECTO FÍSICO LÍQUIDO, TIPO NEUTRO, COMPOSIÇÃO TENSOATIVO ANIÔNICO, (EXTRAN MA02 NEUTRO, GALÃO COM 5 LITROS, MERCK Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: GALÃO 59 - DETERGENTE - INDUSTRIAL DETERGENTE, ASPECTO FÍSICO LÍQUIDO EXTRAN ALCALINO, GALÃO COM 5 LITROS ? MARCA MERCK CATMAT 283054 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: GALÃO 60 - ENZIMA ENZIMA, TIPO TRANSCRIPTASE REVERSA (MMLV), ASPECTO FÍSICO LÍQUIDO, CONCENTRAÇÃO 200.000 UI/ML, COMPONENTES ADICIONAIS TAMPÃO REAÇÃO 5X, COM TRIS-HCL, KCL, MGCL2 E DTT Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 2,00 ML 61 - ÉTER DE PETRÓLEO ÉTER DE PETRÓLEO, ASPECTO FÍSICO LÍQUIDO INCOLOR, LÍMPIDO, COM ODOR DE GASOLINA, FÓRMULA QUÍMICA MISTURA DE HIDROCARBONETOS DERIVADOS DO PETRÓLEO, FAIXA DE DESTILAÇÃO DESTILADOS ENTRE 30¨ E 60¨C, TEOR DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICACAS 8032-32-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: LITRO 62 - ÉTER DIETÍLICO ÉTER DIETÍLICO, COMPOSIÇÃO QUÍMICA (C2H5)2O, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,8%, PESO MOLECULAR 74,12 G/MOL, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 60-29-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: LITRO 63 - FENOL FENOL, ASPECTO FÍSICO CRISTAL INCOLOR, ALTAMENTE HIGROSCÓPICO, FÓRMULA QUÍMICAC6H5OH, PESO MOLECULAR 94,11 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 108- 95-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 64 - FOSFATO DE POTÁSSIO FOSFATO DE POTÁSSIO, ASPECTO FÍSICO PÓ BRANCO CRISTALINO, INODORO, FÓRMULA QUÍMICA K2HPO4 (DIBÁSICO ANIDRO), PESO MOLECULAR 174,18 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7758-11-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 65 - FOSFATO DE SÓDIO FOSFATO DE SÓDIO, ASPECTO FÍSICO PÓ FINO DE CRISTAIS BRANCOS, INODORO, HIGROSCÓPIC O, FÓRMULA QUÍMICA NA2HPO4.7H2O (BIBÁSICO HEPTAHIDRATADO), MASSA MOLECULAR 268,07 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7782-85-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 66 - FOSFATO DE SÓDIO FOSFATO DE SÓDIO, ASPECTO FÍSICO PÓ FINO DE CRISTAIS BRANCOS, INODORO, HIGROSCÓPIC O, FÓRMULA QUÍMICA NAH2PO4 (MONOBÁSICO ANIDRO), MASSA MOLECULAR 119,98 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7558-80-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 67 - FOSFATO DE SÓDIO FOSFATO DE SÓDIO, ASPECTO FÍSICO PÓ FINO DE CRISTAIS BRANCOS, INODORO, HIGROSCÓPIC O, FÓRMULA QUÍMICA NAH2PO4.2H2O (MONOBÁSICO, DIHIDRATADO), MASSA MOLECULAR 156,02 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 13472-35-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 68 - FRUTOSE FRUTOSE, ASPECTO FÍSICO PÓ CRISTALINO INCOLOR A BRANCO, INODORO, PESO MOLECULAR 180,16 G/MOL, FÓRMULA QUÍMICA C6H12O6 (D-FRUTOSE), GRAU DE PUREZA PUREZA MÍNIMA DE 99,9%, CARACTERÍSTICA ADICIONAL PADRÃO DE REFERÊNCIA ANALÍTICO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 57-48-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 69 - EXTRATO CORANTE GEL RED NUCLEIC ACID GEL STAIN 10.000X - DMSO (0,5 ML) (CAT. 41002) MARCA BIOTIUM, Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 70 - EXTRATO CORANTE GELLAN GUM, PÓ, TESTADO PARA CULTURA DE CÉLULAS VEGETAIS (PHYTAGEL SIGMA P8169-250G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 71 - GLICEROL GLICEROL, ASPECTO FÍSICO LÍQUIDO VISCOSO, INCOLOR, HIGROSCÓPICO, FÓRMULA QUÍMICA C3H8O3, PESO MOLECULAR 92,09 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 56-81-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 72 - GLICOSE GLICOSE, ASPECTO FÍSICO PÓ BRANCO FINO, FÓRMULA QUÍMICA C6H12O6 (D+GLICOSE), PESO MOLECULAR 180,16 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE TESTADO EM CULTURA DE CÉLULAS DE INSETO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 492-62-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 73 - FRASCO DE EXPEDICAO GOTAQ GREEN MASTER MIX - 1000 REAÇÕES PROMEGA M7123 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 74 - HIDRÓXIDO DE LÍTIO HIDRÓXIDO DE LÍTIO, ASPECTO FÍSICO PÓ BRANCO, CCRISTALINO, FÓRMULA QUÍMICA LIOH ANIDRO, PESO MOLECULAR 23,95 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1310-65-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 75 - HIDRÓXIDO DE SÓDIO HIDRÓXIDO DE SÓDIO, ASPECTO FÍSICO EM LENTILHAS OU MICRO PÉROLAS ESBRANQUIÇADAS, PESO MOLECULAR 40 G/MOL, FÓRMULA QUÍMICA NAOH, GRAU DE PUREZA PUREZA MÍNIMA DE 99,995%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1310-73-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 76 - HIDRÓXIDO DE SÓDIO HIDRÓXIDO DE SÓDIO, ASPECTO FÍSICO ESCAMAS ESBRANQUIÇADAS, ALTAMENTE HIGROSCÓPICO, PESO MOLECULAR 40 G/MOL, FÓRMULA QUÍMICA NAOH, GRAU DE PUREZA PUREZA MÍNIMA DE 95%, CARACTERÍSTICA ADICIONAL SODA CÁUSTICA COMERCIAL, NÚMERODE REFERÊNCIA QUÍMICA CAS 1310-73-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 77 - HIPOCLORITO DE SÓDIO DILUÍDO HIPOCLORITO DE SÓDIO DILUÍDO, APRESENTAÇÃO LÍQUIDO LÍMPIDO INCOLOR A AMARELADO, CONCENTRAÇÃO TEOR MÍNIMO DE 4% DE CLORO ATIVO, FORMA FARMACÊUTICA SOLUÇÃO AQUOSA ESTABILIZADA, CARACTERÍSTICA ADICIONAL EMBALAGEM COM TAMPA ROSQUEÁVEL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 78 - IODATO DE POTÁSSIO IODATO DE POTÁSSIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO E INODORO, PESO MOLECULAR 214 G/MOL, FóRMULA QUíMICA KIO3 ANIDRO, GRAU DE PUREZA PUREZA MÍNIMADE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7758-05-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 79 - FRASCO DE EXPEDICAO KIT PARA DETERMINAÇÃO DE MORTE CELULAR POR APOPTOSE, COM ANEXINA V E IODETO DE PROPÍDEO (PI), UTILIZANDO CITOMETRIA DE FLUXO (V13242 LIFE). Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: KIT 80 - FRASCO DE EXPEDICAO KIT QPCR FAST SYBR GREEN MASTER MIX, REF. 4385612, VEM COM TODOS OS REAGENTES NECESSÁRIOS PARA PERFORMANCE DE UMA REAÇÃO DE PCR EM TEMPO REAL EM UM ÚNICO TUBO CONSIDERANDO A MOSTRAS DE DNA OU CDNA, 1 EMBALAGEM COM 5 ML PARA 500 REAÇÕES Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 81 - FRASCO DE EXPEDICAO KIT qPCRSybrgreenmix/ROX 5 x 200 REAÇÕES Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: KIT 82 - L-CISTEÍNA L-CISTEÍNA, ASPECTO FÍSICO PÓ CRISTALINO OU CRISTAL BRANCO, FÓRMULA QUÍMICA C3H7NO2.S.HCL.H2O SAL CLORIDRATO, MONOHIDRATADO, PESO MOLECULAR* 175,63 G/MOL,GRAU DE PUREZA PUREZA MÍNIMA DE 98,5%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7048- 04-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 25 Unidade de fornecimento: GRAMA 83 - SISTEMA ESTERILIZACAO - MEIO CULTURA LUPEROX TBH70X, TERT-BUTYL HYDROPEROXIDE SOLUTION 70 WT % IN H2OSYNONYM: 1,1-DIMETHYLETHYL HYDROPEROXIDE, 2-HYDROPEROXY-2-METHYLPROPANE TERT-BUTYL HYDROPEROXIDE SOLUTION. TBHP. FRASCO COM 100 GRAMAS. MARCA SIGMA ALDRICH. BR 119792 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 84 - SISTEMA ESTERILIZACAO - MEIO CULTURA MEIO 199 (1X) LÍQUIDO, MARCA INVITROGEN, REF. 12340-030, FRASCO COM 500 ML Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 85 - SISTEMA ESTERILIZACAO - MEIO CULTURA MEIO BÁSICO DE HUGH E LEIFSON FRASCO COM 500 GRAMAS MARCA MERCK CATÁLOGO 1.10282.0500 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 86 - MEIO DE CULTURA - CÉLULA E TECIDO MEIO DE CULTURA - CÉLULA E TECIDO, TIPO DMEM 4500 MG/L DE GLICOSE, APRESENTAÇÃO LÍQUIDO, CARACTERÍSTICA ADICIONAL SEM L-GLUTAMINA E SEM FENOL VERMELHO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 ML 87 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR BASE COLUMBIA, APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 88 - SISTEMA ESTERILIZACAO - MEIO CULTURA MEIO DE CULTURA, ÁGAR KING B. FRASCO COM 500 GRAMAS. BR 119792 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 89 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR EMB LEVINE (EOSINA AZUL DE METILENO), APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 500,00 G 90 - SISTEMA ESTERILIZACAO - MEIO CULTURA MEIO DE CULTURA, TIPO ÁGAR NUTRIENTE, APRESENTAÇÃO PÓ, CARACTERÍSTICA ADICIONAL SEM EXTRATO DE LEVEDURA. BR 329579 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: KG 91 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR NUTRIENTE, APRESENTAÇÃO PÓ, CARACTERÍSTICA ADICIONAL SEM EXTRATO DE LEVEDURA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 92 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR PCA, APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 93 - MEIO DE CULTURA, MEIO DE CULTURA,, TIPO ÁGAR PEPTONA DEXTROSE, APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 500,00 G 94 - MEIO DE CULTURA. MEIO DE CULTURA., TIPO ÁGAR DEXTROSE TRIPTONA, ASPECTO FÍSICO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 95 - SISTEMA ESTERILIZACAO - MEIO CULTURA MEIO TCM 199 COM HANK S SALTS 25MM HEPES AND L-GLUTAMINE GIBCO REF. 12350-039 FRASCO COM 500ML Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 96 - METABISSULFITO DE SÓDIO METABISSULFITO DE SÓDIO, ASPECTO FÍSICO PÓ BRANCO, DE ODOR SULFUROSO, COMPOSIÇÃO NA2S2O5, PESO MOLECULAR 190,11 G/MOL, TEOR DE PUREZA TEOR MÍNIMO DE98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7681-57-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 97 - METOL METOL, ASPECTO FÍSICO PÓ ESBRANQUIÇADO À ACINZENTADO, FÓRMULA QUÍMICA C7H9NO.12H2SO4 (4-METILAMINOFENOL HEMISSULFATO), PESO MOLECULAR 172,19 G/MOL, GRAU DE PUREZA MÍNIMO DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 55-55-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 98 - FRASCO DE EXPEDICAO MICROAMP FAST OPTICAL 96-WELL PLACA PARA REAÇÕES DE PCR EM TEMPO REAL 0,1ML, CAIXA COM 10UN. Nº 4346907, MARCA APPLIED BIOSYSTEMS - BR 410801 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: CAIXAS 99 - FRASCO DE EXPEDICAO MICROAMP FIME ADESIVO ÓTICO (PARA PCR QUANTITATIVA), CAIXA COM 100UN., MARCA APPLIED BIOSYSTEMS, N¨ 4311971 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: CAIXA 100 - SISTEMA ESTERILIZACAO - MEIO CULTURA MISTURA PADRÃO DE N-ALCANOS (C20-C40/50MG/L) PARA TESTE EM CG MARCA SIGMA COD. 04071 FRASCO COM 5ML. BR 119792 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO

Electronic Auction - Chemical Reagent Procurement Laboratory

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO, Empresa Brasileira de Pesquisa Agropecuária, Embrapa/CPACT, | Published June 29, 2015

1 - EXTRATO CORANTE 1-AMINOCYCLOPROPANECARBOXYLIC ACID 99% (TLC), FRASCO COM 1 GRAMA, SIGMA A3903-1G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: FRASCO 1 GRAMA 2 - EXTRATO CORANTE 3,5-DINITROSALICYLIC ACID, FRASCO COM 25 GRAMAS, SIGMA D0550-25G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 25 GRAMAS 3 - ACETALDEÍDO ACETALDEÍDO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR DE FRUTA, FÓRMULA QUÍMICA CH3CHO, PESO MOLECULAR 44,04 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 75-07-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 4 - ACETATO DE ETILA ACETATO DE ETILA, ASPECTO FÍSICO LÍQUIDO INCOLOR, LÍMPIDO, INFLAMÁVEL, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,9%, COMPOSIÇÃO QUÍMICA C4H8O2, PESO MOLECULAR 88,11G/MOL, CARACTERÍSTICA ADICIONAL REAGENTE UV/HPLC, NÚMERO DE REFERÊNCIA QUÍMICACAS 141-78-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 5 - ACETONA ACETONA, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, FÓRMULA QUÍMICA C3H6O, MASSA MOLECULAR 58,08 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 67- 64-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 70 Unidade de fornecimento: LITRO 6 - ACETONITRILA ACETONITRILA, ASPECTO FÍSICO LÍQUIDO INCOLOR, LÍMPIDO, ODOR DE ÉTER, PESO MOLECULAR 41,05 G/MOL, FÓRMULA QUÍMICA CH3CN, GRAU DE PUREZA PUREZA MÍNIMA DE 99,9%, CARACTERÍSTICA ADICIONAL REAGENTE P/ HPLC, NÚMERO DE REFERÊNCIA QUÍMICACAS 75-05-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: LITRO 7 - ÁCIDO ACÉTICO ÁCIDO ACÉTICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, PESO MOLECULAR 60,05 G/MOL, FÓRMULA QUÍMICA C2H4O2, GRAU DE PUREZA PUREZA MÍNIMA DE 99,7%, CARACTERÍSTICA ADICIONAL GLACIAL,REAGENTE P.A.-ACS-ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-19-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 8 - ÁCIDO ASCÓRBICO ÁCIDO ASCÓRBICO, ASPECTO FÍSICO CRISTAL BRANCO À AMARELADO, FÓRMULA QUÍMICA C6H8O6 ( ÁCIDO L-ASCÓRBICO), PESO MOLECULAR 176,13 G/MOL, PUREZA PUREZA MÍNIMADE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 50-81-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 9 - ÁCIDO ASCÓRBICO ÁCIDO ASCÓRBICO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO A AMARELADO, FÓRMULA QUÍMICA C6H8O6 (ÁCIDO L-ASCÓRBICO), PESO MOLECULAR 176,12 G/MOL, PUREZA PUREZAMÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL PADRÃO DE REFERÊNCIA ANALÍTICO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 50-81-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2500 Unidade de fornecimento: GRAMA 10 - ÁCIDO BÓRICO ÁCIDO BÓRICO, ASPECTO FÍSICO CRISTAL INCOLOR OU PÓ/GRÂNULO BRANCO, INODORO, PESO MOLECULAR 61,83 G/MOL, COMPOSIÇÃO QUÍMICA H3BO3, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 10043-35-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 7500 Unidade de fornecimento: GRAMA 11 - ÁCIDO CÍTRICO ÁCIDO CÍTRICO, ASPECTO FÍSICO CRISTAL INCOLOR, INODORO, SABOR ÁCIDO AGRADÁVEL,FÓRMULA QUÍMICA C6H8O7 ANIDRO, PESO MOLECULAR 192,12 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA* CAS 77-92-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: GRAMA 12 - EXTRATO CORANTE ÁCIDO CLORÍDRICO (HYDROCHLORIC ACID) FRASCO COM 500 ML, SIGMA 320331-500ML Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 500,00 ML 13 - ÁCIDO CLORÍDRICO ÁCIDO CLORÍDRICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR/AMARELADO, FUMEGANTE, PESO MOLECULAR 36,46 G/MOL, FÓRMULA QUÍMICA HCL, TEOR TEOR MÍNIMO DE 37%, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7647-01-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 17 Unidade de fornecimento: LITRO 14 - EXTRATO CORANTE ÁCIDO DINITRO SALICÍLICO (3,5-DINITROSALICYLIC ACID), FRASCO COM 100 GRAMAS, SIGMA D0550-100G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 100,00 GRAMAS 15 - ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA) ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA), ASPECTO FÍSICO PÓ AMARELO, INODORO, PESO MOLECULAR 367,05 G/MOL, FÓRMULA QUÍMICA C10H12N2FENAO8 (EDETATO DE FERRO III E SÓDIO), GRAU DE PUREZA TEOR MÍNIMO DE FERRO 12%, CARACTERÍSTICA ADICIONAL REAGENTE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1578-42-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 25 Unidade de fornecimento: GRAMA 16 - ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA) ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA), ASPECTO FÍSICO PÓ BRANCO CRISTALINO, PESO MOLECULAR 372,24 G/MOL, FÓRMULA QUÍMICA C10H14N2O8NA2.2H2O (SAL DISSÓDICODIHIDRATADO), GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 6381-92-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: QUILOGRAMA 17 - ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA) ÁCIDO ETILENODIAMINOTETRACÉTICO (EDTA), FÓRMULA QUÍMICA C10H14N2O8NA2.2H2O, COMPOSIÇÃO QUÍMICA SAL DISSÓDICO DIHIDRATADO, ASPECTO FÍSICO´ PÓ BRANCO, CRISTALINO, MASSA MOLAR 372,24 G/MOL, GRAU DE PUREZA* PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL* PADRÃO DE REFERENCIA ANALÍTICO, NÚMERO DE REFERÊNCIAQUÍMICA* CAS 6381-92-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 18 - ÁCIDO MÁLICO ÁCIDO MÁLICO, ASPECTO FÍSICO PÓ OU GRÂNULO CRISTALINO, ESBRANQUIÇADO, INODORO,FÓRMULA QUÍMICA C4H6O5 (ÁCIDO DL-MÁLICO), PESO MOLECULAR 134,09 G/MOL, GRAU DEPUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 617-48-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: GRAMA 19 - ÁCIDO NÍTRICO ÁCIDO NÍTRICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO,INCOLOR À AMARELADO,ODOR SUFOCANT E, FÓRMULA QUÍMICA HNO3, PESO MOLECULAR 63,01 G/MOL, GRAU DE PUREZA TEOR MÍNIMO DE 65%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7697-37-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: LITRO 20 - ÁCIDO FOSFÓRICO ÁCIDO FOSFÓRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR, INODORO, FÓRMULA QUÍMICA H3PO4, PESO MOLECULAR 98,00 G/MOL, TEOR DE PUREZA TEOR MÍNIMO DE 85%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7664-38-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 21 - ÁCIDO P-AMINOBENZÓICO ÁCIDO P-AMINOBENZÓICO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO A LEVEMENTE AMARELADO, FÓRMULA QUÍMICA C7H7NO2 (ÁCIDO 4-AMINOBENZÓICO), PESO MOLECULAR 137,14 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA 98,5%, NÚMERO DE REFERÊNCIA QUÍMICACAS 150-13-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 25 Unidade de fornecimento: GRAMA 22 - ÁCIDO PERCLÓRICO ÁCIDO PERCLÓRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR OU LEVEMENTE AMARELADO, PESO MOLECULAR 100,46 G/MOL, FÓRMULA QUÍMICA HCLO4, GRAU DE PUREZA CONCENTRAÇÃO MÍNIMA DE 70%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7601-90-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 23 - ÁCIDO PROPIÔNICO ÁCIDO PROPIÔNICO, PESO MOLECULAR 74,08 G/MOL, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, FÓRMULA QUÍMICA C3H6O2, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 79- 09-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 24 - ÁCIDO SULFÚRICO ÁCIDO SULFÚRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR, INODORO, VISCOSO, CRISTALINO,FÓRMULA QUÍMICA H2SO4, MASSA MOLECULAR 98,09 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 95%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7664-93-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 60 Unidade de fornecimento: LITRO 25 - ÁCIDO PÍCRICO ÁCIDO PÍCRICO, COMPOSIÇÃO QUÍMICA 2,4,6-(NO2)3C6H2OH, ASPECTO FÍSICO PÓ CRISTALINO AMARELO, INODORO, PESO MOLECULAR 229,11 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99% EM BASE ANIDRA, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 88-89-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 26 - ÁGAR ÁGAR, TIPO ÁGAR BACTERIOLÓGICO, ASPECTO FÍSICO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: FRASCO 1.000,00 G 27 - ÁGAR ÁGAR, TIPO ÁGAR BACTERIOLÓGICO, ASPECTO FÍSICO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 24 Unidade de fornecimento: FRASCO 500,00 G 28 - AGAROSE AGAROSE, ASPECTO FÍSICO PÓ, TIPO DE BAIXA ELETROENDOSMOSE, CARACTERÍSTICAS ADICIONAIS LIVRE DE DNASE E RNASE, RESISTÊNCIA MAIOR OU IGUAL A 1200 G/CM² (GEL A 1%) Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 ML 29 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, TEOR ALCOÓLICO 95,1 A 96¨GL, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/MOL, GRAU DE PUREZA 92,6% A 93,8% P/P INPM, CARACTERÍSTICA ADICIONAL HIDRATADO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-17-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 52 Unidade de fornecimento: LITRO 30 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, TEOR ALCOÓLICO MÍNIMO DE 99,5¨GL, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/ MOL, GRAU DE PUREZA MÍNIMO DE 99,7% P/P INPM, CARACTERÍSTICA ADICIONAL ABSOLUTO, REAGENTE P.A. ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-17-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: LITRO 31 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, TIPO HIDRATADO, TEOR ALCOÓLICO 70%_(70¨GL), APRESENTAÇÃO LÍQUIDO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 48 Unidade de fornecimento: FRASCO 1.000,00 ML 32 - ÁLCOOL PROPÍLICO ÁLCOOL PROPÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO, FÓRMULA QUÍMICA (CH3)2CHOH (ISOPROPÍLICO OU ISO-PROPANOL), PESO MOLECULAR* 60,10 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,7%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-63-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: LITRO 33 - ÁLCOOL PROPÍLICO ÁLCOOL PROPÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO, FÓRMULA QUÍMICA CH3(CH2)2OH (1-PROPANOL OU NORMAL), PESO MOLECULAR* 60,10 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,7%, CARACTERÍSTICA ADICIONAL REAGENTE P/ UV/HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 71-23-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 34 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO AMICACINA, DOSAGEM 30 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: DISCO 35 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO AMOXICILINA E ÁCIDO CLAVULÂNICO, DOSAGEM 20 + 10MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: DISCO 36 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO ESTREPTOMICINA, DOSAGEM 10 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: DISCO 37 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO GENTAMICINA, DOSAGEM 10 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: DISCO 38 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO NEOMICINA, DOSAGEM 30 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: DISCO 39 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO POLIMIXINA B, DOSAGEM 300 UI Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: DISCO 40 - ANTIBIOGRAMA ANTIBIOGRAMA, PRINCÍPIO ATIVO TETRACICLINA, DOSAGEM 30 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: DISCO 41 - ANTIBIOGRAMA. ANTIBIOGRAMA., PRINCÍPIO ATIVO CEFTIOFUR, DOSAGEM 30 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: DISCO 42 - ANTIBIOGRAMA. ANTIBIOGRAMA., PRINCÍPIO ATIVO ENROFLOXACINO, DOSAGEM 5 MCG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: DISCO 43 - ALGICIDA ALGICIDA, COMPOSIÇÃO QUATERNÁRIO POLIMÉRICO DIALQUIL HIDROXI ALQUIL AM Ô, USO TRATAMENTO DE ÁGUA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: FRASCO 1,00 L 44 - EXTRATO CORANTE AQUAFLOC 930 (FLOCULANTE/CLARIFICANTE INORGÂNICO PARA USO EM EFLUENTES) BB COM 50KG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: BOMBONA 50 KG 45 - EXTRATO CORANTE AQUAPLUS 50 (ALCALINIZANTE PARA USO EM EFLUENTES) BB COM 50 KG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: BOMBONA 50 KG 46 - EXTRATO CORANTE B-GLUCOSIDADE, THERMOSTABLE, FRASCO COM 02MG, SIGMA G8798-2MG Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 2 MG 47 - BROMETO DE CETILTRIMETILAMÔNIO BROMETO DE CETILTRIMETILAMÔNIO, ASPECTO FÍSICO PÓ BRANCO CRISTALINO, FÓRMULA QUÍMICA (CH3)(CH2)15 N(BR)(CH3)3, PESO MOLECULAR 364,45 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 57-09-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 12000 Unidade de fornecimento: GRAMA 48 - BROMETO DE ETÍDIO BROMETO DE ETÍDIO, ASPECTO FÍSICO PÓ CRISTALINO VERMELHO ESCURO, FÓRMULA QUÍMICA C21H20BRN3, PESO MOLECULAR 394,31 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 95%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1239-45-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 49 - EXTRATO CORANTE CALDO DETECÇÃO SELETIVA COLIFORMES TOTAIS E ESCHERICHIA COLI COM SUBSTRATO CROMOGÊNIO-FLUORESCENTE, FRASCO COM 500 GRAMAS, REF. CALDO HICOLIFORME HIMEDIA - BR 408984 FRASCO COM 500 GRAMAS Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 50 - EXTRATO CORANTE GARAMICINA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: KG 51 - CARBONATO DE CÁLCIO CARBONATO DE CÁLCIO, ASPECTO FÍSICO PRECIPITADO,PÓ BRANCO, FINO, INODORO, HIGROSCÓPIC O, PESO MOLECULAR 100,09 G/MOL, FÓRMULA QUÍMICA CACO3, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERISTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 471-34-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 250 Unidade de fornecimento: GRAMA 52 - CARBONATO DE SÓDIO CARBONATO DE SÓDIO, ASPECTO FÍSICO PÓ OU CRISTAIS BRANCOS, HIGROSCÓPICOS, INODOROS, FÓRMULA QUÍMICA NA2CO3 ANIDRO, PESO MOLECULAR 105,99 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 497-19-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 53 - CARVÃO ATIVADO CARVÃO ATIVADO, ASPECTO FÍSICO GRÂNULO PRETO, INODORO, PESO MOLECULAR 12,01 G/MOL, FÓRMULA QUÍMICA C, GRAU DE PUREZA PUREZA MÍNIMA DE 90%, CARACTERÍSTICA ADICIONAL GRANULOMETRIA ESPECÍFICA, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7440-44- 0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 54 - CASEÍNA CASEÍNA, FÓRMULA QUÍMICA HIDROLISADO ÁCIDO DE CASEÍNA, ASPECTO FÍSICO* PÓ AMARELO CLARO, NÚMERO DE REGISTRO QUÍMICO CAS 91079-40-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 55 - CICLOHEXIMIDA CICLOHEXIMIDA, ASPECTO FÍSICO CRISTAL INCOLOR, FÓRMULA QUÍMICA C15H23NO4, MASSA MOLECULAR 281,34 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 66-81-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: GRAMA 56 - CLORETO DE CÁLCIO CLORETO DE CÁLCIO, ASPECTO FÍSICO PÓ, GRANULADO OU ESCAMA BRANCA OU ROSADA, OPACA, FÓRMULA QUÍMICA CACL2.2H20, MASSA MOLECULAR 147,01 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 10035-04-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 57 - CLORETO DE CÁLCIO CLORETO DE CÁLCIO, ASPECTO FÍSICO PÓ, GRANULADO OU ESCAMA BRANCA OU ROSADA, OPACA, FÓRMULA QUÍMICA CACL2.2H20, MASSA MOLECULAR 147,01 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 10035-04-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1500 Unidade de fornecimento: GRAMA 58 - CLORETO DE COLINA CLORETO DE COLINA, ASPECTO FÍSICO PÓ CRISTALINO BRANCO, LEVE ODOR DE AMINA, FÓRMULA QUÍMICA C5H14NO.CL, PESO MOLECULAR 139,63 G/MOL, GRAU DE PUREZA PUREZAMÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE TESTADO EM CULTURA DE CÉLULAS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-48-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 500,00 G 59 - CLORETO DE SÓDIO CLORETO DE SÓDIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO OU CRISTAIS INCOLORES, COMPOSIÇÃO QUÍMICA NACL ANIDRO, PESO MOLECULAR 58,45 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL PADRÃO PRIMÁRIO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7647-14-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: GRAMA 60 - CLORETO DE SÓDIO CLORETO DE SÓDIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO OU CRISTAIS INCOLORES, COMPOSIÇÃO QUÍMICA NACL ANIDRO, PESO MOLECULAR 58,45 G/MOL, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS ISO, NÚMERODE REFERÊNCIA QUÍMICA CAS 7647-14-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 61 - CLOROFÓRMIO CLOROFÓRMIO, ASPECTO FÍSICO LÍQUIDO CLARO, INCOLOR, ODOR FORTE CARACTERÍSTICO,PESO MOLECULAR 119,38 G/MOL, FÓRMULA QUÍMICA CHCL3, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-66-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 62 - COLCHICINA COLCHICINA, ASPECTO FÍSICO PÓ BRANCO A AMARELADO, CRISTALINO, FÓRMULA QUÍMICA C22H25NO6, PESO MOLECULAR 399,44 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 95%, CARACTERÍSTICA ADICIONAL REAGENTE P/ HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 6486-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: GRAMA 63 - CORANTE CORANTE, TIPO AZUL BRILHANTE COOMASSIE G-250, ASPECTO FÍSICO PÓ, CARACTERÍSTICAS ADICIONAIS CI 42655 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 25,00 G 64 - CORANTE CORANTE, TIPO FAST BLUE RR SALT, ASPECTO FÍSICO PÓ, CARACTERÍSTICAS ADICIONAISCI 37155 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 25,00 G 65 - EXTRATO CORANTE D-FRUTOSE 6-PHOSPHATE DIPOTASSIUM SALT, FRASCO COM 1 GRAMA, SIGMA F1502-1G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 1 GRAMA 66 - EXTRATO CORANTE D-GLUCOSE 6-PHOSPHATE SOLUTION, FRASCO COM 1 GRAMAS, SIGMA G6526-1G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 1 GRAMA 67 - DETERGENTE SANEANTE DETERGENTE SANEANTE, ASPECTO FÍSICO LÍQUIDO, TIPO NEUTRO, COMPOSIÇÃO TENSOATIVO ANIÔNICO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 35 Unidade de fornecimento: LITRO 68 - EXTRATO CORANTE DTT DITHIOTHREITOL, FRASCO COM 5 GRAMAS, SIGMA D0632-5G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: frasco 5,00 G 69 - ESTREPTOMICINA ESTREPTOMICINA, COMPOSIÇÃO QUÍMICA SULFATO DE ESTREPTOMICINA, FÓRMULA QUÍMICA*C21H39N7O12. 1,5 H2SO4, ASPECTO FÍSICO* PÓ BRANCO OU QUASE BRANCO, MASSA MOLAR728,69 G/MOL, POTÊNCIA 650 A 850 MCG/MG, NÚMERO DE REFERÊNCIA QUÍMICA* CAS 3810-74-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 70 - ÉTER DE PETRÓLEO ÉTER DE PETRÓLEO, ASPECTO FÍSICO LÍQUIDO INCOLOR, LÍMPIDO, COM ODOR DE GASOLINA, FÓRMULA QUÍMICA MISTURA DE HIDROCARBONETOS DERIVADOS DO PETRÓLEO, FAIXA DE DESTILAÇÃO DESTILADOS ENTRE 30¨ E 60¨C, TEOR DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICACAS 8032-32-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 32 Unidade de fornecimento: LITRO 71 - ÉTER DIETÍLICO ÉTER DIETÍLICO, COMPOSIÇÃO QUÍMICA (C2H5)2O, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,5%, PESO MOLECULAR 74,12 G/MOL, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ANIDRO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 60-29-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 13 Unidade de fornecimento: LITRO 72 - ETILENOGLICOL (ETANO-1,2-DIOL) ETILENOGLICOL (ETANO-1,2-DIOL), ASPECTO FÍSICO LÍQUIDO INCOLOR, ODOR ADOCICADO, PESO MOLECULAR 62,07 G/MOL, FÓRMULA QUÍMICA C2H6O2, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 107-21-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15 Unidade de fornecimento: LITRO 73 - FENAZINA FENAZINA, ASPECTO FÍSICO PÓ CRISTALINO AMARELO, FÓRMULA QUÍMICA C14H14N2O4S (METASULFATO DE FENAZINA), MASSA MOLECULAR 306,3 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 299-11-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: MILIGRAMA 74 - FENOL FENOL, ASPECTO FÍSICO LÍQUIDO INCOLOR, ODOR ADOCICADO CARACTERÍSTICO, FÓRMULA QUÍMICA C6H5OH, PESO MOLECULAR 94,11 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,9%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 108-95-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 75 - FORMALDEÍDO (FORMOL) FORMALDEÍDO (FORMOL), ASPECTO FÍSICO LÍQUIDO INCOLOR, LÍMPIDO, FÓRMULA QUÍMICAH2CO, PESO MOLECULAR 30,03 G/MOL, GRAU DE PUREZA CONCENTRAÇÃO MÍNIMA DE 36,5%,CARACTERISTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 50-00-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 76 - FOSFATO DE CÁLCIO FOSFATO DE CÁLCIO, ASPECTO FÍSICO PÓ BRANCO, FÓRMULA QUÍMICA CA3(PO4)2 (BETA- FOSFATO TRICÁLCIO), PESO MOLECULAR 310,18 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 95%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7758-87-4 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 77 - FOSFATO DE POTÁSSIO FOSFATO DE POTÁSSIO, ASPECTO FÍSICO PÓ BRANCO CRISTALINO, INODORO, FÓRMULA QUÍMICA KH2PO4 (MONOBÁSICO ANIDRO), PESO MOLECULAR 136,09 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DEREFERÊNCIA QUÍMICA CAS 7778-77-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: QUILOGRAMA 78 - GLICEROL GLICEROL, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, VISCOSO, INCOLOR, HIGROSCÓPICO, FÓRMULA QUÍMICA HOCH2CH(OH)CH2OH, PESO MOLECULAR 92,09 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE ISENTO DE DNASE, RNASEE PROTEASE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 56-81-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 79 - GLICINA GLICINA, ASPECTO FÍSICO CRISTAL BRANCO, INODORO, PESO MOLECULAR 75,07 G/MOL, FÓRMULA QUÍMICA C2H5NO2, GRAU DE PUREZA PUREZA MÍNIMA DE 98,5%, CARACTERÍSTICAADICIONAL REAGENTE ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 56-40-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: GRAMA 80 - CONJUNTO PARA ANÁLISE CONJUNTO PARA ANÁLISE, COMPOSIÇÃO BÁSICA MISTURA PARA REAÇÃO, APLICAÇÃO PARA PCR, COMPONENTES TAQ DNA POLIMERASE RECOMBINANTE, DNTPS, MGCL2, OUTROS COMPONENTES SOLUÇÕES TAMPÃO, 1X Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 81 - CONJUNTO PARA ANÁLISE CONJUNTO PARA ANÁLISE, APLICAÇÃO P/ AMPLIFICAÇÃO PRODUTOS DE PCR LONGOS, COMPONENTES MISTURA REAÇÃO, DNTPS, SOLUÇÕES TAMPÃO, OUTROS COMPONENTES TAQ DNAPOLIMERASE TERMOESTÁVEL, COMPONENTES ADICIONAIS SOLUÇÃO PARA AMPLIFICAÇÃO ALTOCONTEÚDO GC Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: UNIDADE 82 - HEXANO HEXANO, ASPECTO FÍSICO LÍQUIDO TRANSPARENTE, PESO MOLECULAR 86,18 G/MOL, COMPOSIÇÃO QUÍMICA C6H14 (N-HEXANO), TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 110- 54-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: LITRO 83 - HEXANO HEXANO, ASPECTO FÍSICO LÍQUIDO TRANSPARENTE, PESO MOLECULAR 86,18 G/MOL, COMPOSIÇÃO QUÍMICA C6H14 (N-HEXANO), TEOR DE PUREZA TEOR MÍNIMO DE 85%, PUREZAMÍNIMA DE 99,8%, CARACTERÍSTICA ADICIONAL REAGENTE P/ HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 110-54-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 84 - HIDRÓXIDO DE SÓDIO HIDRÓXIDO DE SÓDIO, ASPECTO FÍSICO EM LENTILHAS OU MICRO PÉROLAS ESBRANQUIÇADAS, PESO MOLECULAR 40 G/MOL, FÓRMULA QUÍMICA NAOH, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1310-73-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15500 Unidade de fornecimento: GRAMA 85 - HIDRÓXIDO DE SÓDIO HIDRÓXIDO DE SÓDIO, ASPECTO FÍSICO ESCAMAS ESBRANQUIÇADAS, ALTAMENTE HIGROSCÓPICO, PESO MOLECULAR 40 G/MOL, FÓRMULA QUÍMICA NAOH, GRAU DE PUREZA PUREZA MÍNIMA DE 95%, CARACTERÍSTICA ADICIONAL SODA CÁUSTICA COMERCIAL, NÚMERODE REFERÊNCIA QUÍMICA CAS 1310-73-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 86 - ÁLCOOL PROPÍLICO ÁLCOOL PROPÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO, FÓRMULA QUÍMICA (CH3)2CHOH (ISOPROPÍLICO OU ISO-PROPANOL), PESO MOLECULAR* 60,10 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. LIVRE DE DNASE E RNASE, NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-63- 0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: LITRO 87 - L-CISTEÍNA L-CISTEÍNA, ASPECTO FÍSICO PÓ CRISTALINO OU CRISTAL BRANCO, FÓRMULA QUÍMICA C3H7NO2.S.HCL.H2O SAL CLORIDRATO, MONOHIDRATADO, PESO MOLECULAR* 175,63 G/MOL,GRAU DE PUREZA PUREZA MÍNIMA DE 98,5%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7048- 04-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 25 Unidade de fornecimento: GRAMA 88 - LAURILSULFATO DE SÓDIO LAURILSULFATO DE SÓDIO, ASPECTO FÍSICO PÓ BRANCO OU LEVEMENTE AMARELADO, INODORO, FÓRMULA QUÍMICA C12H25NAO4S, MASSA MOLECULAR 288,38 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DEREFERÊNCIA QUÍMICA CAS 151-21-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20500 Unidade de fornecimento: GRAMA 89 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR BASE COLUMBIA, APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 90 - EXTRATO CORANTE MEIO DE CULTURA ÁGAR MANITA COMUM, FRASCO COM 500 GRAMAS, REF. HIMEDIA M-118 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 91 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR EMB LEVINE (EOSINA AZUL DE METILENO), APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 500,00 G 92 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR INFUSO DE CÉREBRO E CORAÇÃO (BHI), APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 93 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR MACCONKEY, APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 94 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR MUELLER HINTON, APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 95 - MEIO DE CULTURA. MEIO DE CULTURA., TIPO ÁGAR DEXTROSE TRIPTONA, ASPECTO FÍSICO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 500,00 G 96 - MERCAPTOETANOL MERCAPTOETANOL, ASPECTO FÍSICO LÍQUIDO INCOLOR, ODOR DESAGRADÁVEL, FÓRMULA QUÍMICA C2H6SO, PESO MOLECULAR 78,13 G/MOL, TEOR PUREZA PUREZA MÍNIMA DE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 60-24-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 97 - PLACA LABORATÓRIO PLACA LABORATÓRIO, TIPO PARA PCR, MATERIAL PLÁSTICO, CAPACIDADE 96 POÇOS, TIPOFUNDO FUNDO EM ´V´, ADICIONAL COM MEIA BORDA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: UNIDADE 98 - EXTRATO CORANTE NADH (B-NICOTINAMIDE ADENINE DINUCLEOTIDE, REDUCED DISODIUM SALT HYDRATE), FRASCO COM 1 GRAMAS, SIGMA N8129-1G Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 1 GRAMA 99 - EXTRATO CORANTE NIPAGIN (PARAHIDROXIBENZOATO), FRASCO COM 500 GRAMAS Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 11 Unidade de fornecimento: FRASCO 500,00 G 100 - NITRATO DE AMÔNIO NITRATO DE AMÔNIO, PESO MOLECULAR 80,04 G/MOL, ASPECTO FÍSICO PÓ FINO, CRISTALINO. ESBRANQUIÇADO, FÓRMULA QUÍMICA NH4NO3, GRAU DE PUREZA PUREZA MÍNIMA DE 98%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 6484-52-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA

Electronic Auction - Chemical Material Acquisition and Laboratory

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO, Empresa Brasileira de Pesquisa Agropecuária, Embrapa/CPACT, | Published April 13, 2015

1 - BÉQUER BÉQUER, MATERIAL VIDRO, GRADUAÇÃO GRADUADO, CAPACIDADE 100 ML, FORMATO FORMA ALTA, ADICIONAL COM ORLA E BICO Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: UNIDADE 2 - FRASCO - TIPO ALMOTOLIA FRASCO - TIPO ALMOTOLIA, MATERIAL POLIETILENO (PLÁSTICO), TIPO BICO BICO CURVO, TIPO TAMPA TAMPA EM ROSCA, COR TRANSPARENTE, CAPACIDADE 500 ML, GRADUAÇÃO GRADUADO Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: UNIDADE 3 - PIPETA PIPETA, TIPO PASTEUR, GRADUAÇÃO GRADUADA, CAPACIDADE 3 ML, MATERIAL PLÁSTICO, ESCALA ESCALA 0,5 EM 0,5 ML, TIPO USO DESCARTÁVEL Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: UNIDADE 4 - MICROPIPETA MICROPIPETA, CAPACIDADE ASPIRAÇÃO ATÉ 5000 MCL, TIPO* MONOCANAL, MECÂNICA, AJUSTE VOLUME REGULÁVEL, COMPONENTES COM EJETOR DE PONTEIRA, SUPORTE Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 5 - MICROPIPETA MICROPIPETA, CAPACIDADE ASPIRAÇÃO ATÉ 1000 MCL, TIPO* MONOCANAL, MECÂNICA, AJUSTE VOLUME REGULÁVEL, COMPONENTES COM EJETOR DE PONTEIRA, SUPORTE Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 6 - ÁCIDO ACÉTICO ÁCIDO ACÉTICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO TRANSPARENTE, PESO MOLECULAR 60,05 G/MOL, FÓRMULA QUÍMICA C2H4O2, GRAU DE PUREZA PUREZA MÍNIMA DE 99,7%, CARACTERÍSTICA ADICIONAL GLACIAL,REAGENTE P.A.-ACS-ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-19-7 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 7 - ÁCIDO CLORÍDRICO ÁCIDO CLORÍDRICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR/AMARELADO, FUMEGANTE, PESO MOLECULAR 36,46 G/MOL, FÓRMULA QUÍMICA HCL, TEOR TEOR MÍNIMO DE 37%, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7647-01-0 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 8 - ÁCIDO SULFÚRICO ÁCIDO SULFÚRICO, ASPECTO FÍSICO LÍQUIDO INCOLOR, INODORO, VISCOSO, CRISTALINO,FÓRMULA QUÍMICA H2SO4, MASSA MOLECULAR 98,09 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 95%, CARACTERÍSTICA ADICIONAL REAGENTE P.A./ ACS ISO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7664-93-9 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 9 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/MOL, GRAU DE PUREZA MÍNIMO DE 95% P/P INPM, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS64-17-5 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: LITRO 10 - CLOROFÓRMIO CLOROFÓRMIO, ASPECTO FÍSICO LÍQUIDO CLARO, INCOLOR, ODOR FORTE CARACTERÍSTICO,PESO MOLECULAR 119,38 G/MOL, FÓRMULA QUÍMICA CHCL3, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-66-3 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 11 - ÉTER DIETÍLICO ÉTER DIETÍLICO, COMPOSIÇÃO QUÍMICA (C2H5)2O, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO, PUREZA MÍNIMA PUREZA MÍNIMA DE 99,8%, PESO MOLECULAR 74,12 G/MOL, CARACTERÍSTICA ADICIONAL REAGENTE P/ HPLC, NÚMERO DE REFERÊNCIA QUÍMICA CAS 60-29-7 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: LITRO 12 - HEPTANO HEPTANO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO,INCOLOR,ODOR SEMELHANTE A GASOLIN A, COMPOSIÇÃO QUÍMICA C7H16, PESO MOLECULAR 100,21 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL ABOLUTO, REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 142-82-5 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: - Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: LITRO 13 - BIFTALATO DE POTÁSSIO BIFTALATO DE POTÁSSIO, ASPECTO FÍSICO PÓ OU CRISTAL BRANCO OU INCOLOR, INODORO, PESO MOLECULAR 204,23 G/MOL, FÓRMULA QUÍMICA HOOC-C6H4COOK, GRAU DE PUREZA PUREZA MÍNIMA DE 99,95%, CARACTERÍSTICA ADICIONAL REAGENTE PADRÃO PRIMÁRIO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 877-24-7 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 14 - DECANOL DECANOL, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR SUAVE DE FLORES, PESO MOLECULAR 158,29 G/MOL, FÓRMULA QUÍMICA C10H22O (1-DECANOL OU ÁLCOOL CÁPRICO),GRAU DE PUREZA PUREZA MÍNIMA DE 99%, NÚMERO DE REFERÊNCIA QUÍMICA CAS 112-30- 1 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 15 - ANALISADOR QUÍMICO HYDRANAL COULOMAT AG, FLUKA CÓD. 34836-1L Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 16 - ANALISADOR QUÍMICO HYDRANAL COULOMAT CG, CAIXA COM 10 AMPOLAS DE 5ML, FLUKA CÓD. 34840-50ML-R Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: CAIXA 10,00 AMP 17 - IODATO DE POTÁSSIO IODATO DE POTÁSSIO, ASPECTO FÍSICO PÓ CRISTALINO BRANCO E INODORO, PESO MOLECULAR 214 G/MOL, FóRMULA QUíMICA KIO3 ANIDRO, GRAU DE PUREZA PUREZA MÍNIMADE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 7758-05-6 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 18 - IODETO DE POTÁSSIO IODETO DE POTÁSSIO, ASPECTO FÍSICO PÓ BRANCO, CRISTALINO, INODORO, FÓRMULA QUÍMICA KI, PESO MOLECULAR 166,01 G/MOL, TEOR DE PUREZA PUREZA MÍNIMA DE 99,5%, CARACTERÍSTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS7681-11-0 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 19 - IODO IODO, ASPECTO FÍSICO CRISTAL PRETO AZULADO, DE BRILHO METÁLICO, PESO MOLECULAR253,81 G/MOL, COMPOSIÇÃO QUÍMICA I2, TEOR DE PUREZA PUREZA MÍNIMA DE 99,8%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7553-56-2 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: GRAMA 20 - ANALISADOR QUÍMICO ISOOCTANO (2,2,4-TRIMETHYLPENTANO) PARA ESPECTROFOTOMETRIA, CAS 540841, DEVE TER EM RELAÇÃO A ÁGUA DESTILADA, UMA TRANSMITÂNCIA DE 60%, NO MÍNIMO, A 220NM E DE 95%, NO MÍNIMO 250NM Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 21 - REAGENTE ANALÍTICO REAGENTE ANALÍTICO, COMPOSIÇÃO SOLUÇÃO DE WIJS, CONCENTRAÇÃO 0,1 M Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: FRASCO 1.000,00 ML 22 - SULFATO DE SÓDIO SULFATO DE SÓDIO, ASPECTO FÍSICO FINOS GRÂNULOS BRANCOS CRISTALINOS, INODOROS,PESO MOLECULAR 142,04 G/MOL, FÓRMULA QUÍMICA NA2.SO4 ANIDRO, GRAU DE PUREZA PUREZA MÍNIMA DE 99%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 7757-82-6 Tratamento Diferenciado: Tipo I - Participação Exclusiva de ME/EPP Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA Grupos G1 1 - BÉQUER 2 - FRASCO - TIPO ALMOTOLIA 3 - PIPETA G2 4 - MICROPIPETA 5 - MICROPIPETA G3 6 - ÁCIDO ACÉTICO 7 - ÁCIDO CLORÍDRICO 8 - ÁCIDO SULFÚRICO 9 - ÁLCOOL ETÍLICO 10 - CLOROFÓRMIO 11 - ÉTER DIETÍLICO 12 - HEPTANO

Electronic Bidding - Chemical Consumables Acquisition and Hospital Dentistry

MINISTÉRIO DA EDUCAÇÃO, Universidade Federal de Pelotas, Pró-Reitoria Administrativa, | Published January 27, 2016

1 - ALGODÃO ALGODÃO, TIPO HIDRÓFILO, APRESENTAÇÃO EM MANTAS, MATERIAL ALVEJADO, PURIFICADO, ISENTO DE IMPUREZAS, CARACTERÍSTICAS ADICIONAIS ENROLADO EM PAPEL APROPRIADO, ESTERILIDADE NÃO ESTÉRIL, TIPO EMBALAGEM EMBALAGEM INDIVIDUAL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 400 Unidade de fornecimento: EMBALAGEM 500,00 G 2 - COLETOR MATERIAL PÉRFURO-CORTANTE COLETOR MATERIAL PÉRFURO-CORTANTE, MATERIAL PAPELÃO, CAPACIDADE TOTAL 7 L, ACESSÓRIOS ALÇAS RÍGIDAS E TAMPA, COMPONENTES ADICIONAIS REVESTIMENTO INTERNO EM POLIETILENO ALTA DENSIDAD E, TIPO USO DESCARTÁVEL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: UNIDADE 3 - COMPRESSA GAZE COMPRESSA GAZE, MATERIAL TECIDO 100% ALGODÃO, TIPO 9 FIOS/CM2, MODELO COR BRANCA,ISENTA DE IMPUREZAS, CAMADAS 8 CAMADAS, LARGURA 7,50 CM, COMPRIMENTO 7,50 CM, DOBRAS 5 DOBRAS, CARACTERÍSTICAS ADICIONAIS DESCARTÁVEL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2000 Unidade de fornecimento: PACOTE 500,00 UN 4 - COMPRESSA GAZE COMPRESSA GAZE, MATERIAL TECIDO 100% ALGODÃO, TIPO 13 FIOS/CM2, MODELO COR BRANCA,ISENTA DE IMPUREZAS, CAMADAS 8 CAMADAS, LARGURA 7,50 CM, COMPRIMENTO 7,50 CM, DOBRAS 5 DOBRAS, CARACTERÍSTICAS ADICIONAIS ESTÉRIL,DESCARTÁVEL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4000 Unidade de fornecimento: PACOTE 10,00 UN 5 - COMPRESSA GAZE COMPRESSA GAZE, MATERIAL TECIDO 100% ALGODÃO, TIPO 13 FIOS/CM2, MODELO COR BRANCA,ISENTA DE IMPUREZAS, CAMADAS 8 CAMADAS, LARGURA 7,50 CM, COMPRIMENTO 7,50 CM, DOBRAS 5 DOBRAS, CARACTERÍSTICAS ADICIONAIS C/ FIO RADIOPACO,ESTÉRIL,DESCARTÁVEL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3000 Unidade de fornecimento: PACOTE 500,00 UN 6 - DESINCROSTANTE DESINCROSTANTE, COMPOSIÇÃO A BASE DE FOSFATO TRISSÓDICO, TIPO ALCALINO, ASPECTO FÍSICO PÓ BRANCO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: EMBALAGEM 1,00 KG 7 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Embalagem para esterilização (pouch), material papel grau cirúrgico c/filme laminado transparente, comprimento 23cm, largura 09cm, tipo uso autoselante, características adicionais p/ esterilização a vapor, em forma de envelope, toxidade apirogênico, atóxico, caixa c/ 200 folhas Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: Caixa c/ 200 folhas 8 - ABAIXADOR LÍNGUA ABAIXADOR LÍNGUA, MATERIAL MADEIRA, TIPO DESCARTÁVEL, COMPRIMENTO 14 CM, FORMATO TIPO ESPÁTULA, LARGURA 1,50 CM, ESPESSURA 2 MM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1000 Unidade de fornecimento: PACOTE 100,00 UN 9 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS fio de sutura, material ácido poliglicólico (pga), tipo fio 5-0, cor violeta, características adicionais com agulha, tipo agulha 1/2 círculo cilíndrica, comprimento agulha 1,5 cm a 1,75, esterilidade estéril, cx c/ 24 envelopes Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: Caix c/ 24 envelopes 10 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Fio de sutura, material nylon monofilamento, tipo fio 4-0, cor preto, comprimento 45, características adicionais com agulha, tipo agulha 1/2 círculo cortante, comprimento agulha 2,5, esterilidade estéril, cx c/ 24 envelopes Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: Caixa 24 envelopes 11 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Fita adesiva, material papel crepado, tipo monoface, tipo fita para autoclave, largura 19, comprimento 30, cor bege, características adicionais listras em tinta termo-reativa que reage com a temperatura da autoclave mudando de cor, adesivo a base de borracha e resina, aplicação indicador de passagem pelo processo de autoclavagem. Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: ROLO 12 - FITA ADESIVA HOSPITALAR FITA ADESIVA HOSPITALAR, TIPO MICROPOROSA, MATERIAL NÃO TECIDO DE VISCOSE RAYON, COR BRANCA, LARGURA 25 MM, COMPRIMENTO 10 M, TIPO ADESIVO C/ ADESIVO ACRÍLICO HIPO-ALERGÊNICO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 150 Unidade de fornecimento: ROLO 10,00 M 13 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS hipoclorito de sódio diluído, concentração contendo 1% de cloro ativo, forma farmacêutica solução aquosa estabilizada com cloreto de sódio, característica adicional embalagem com tampa rosqueável, frasco c/ 1000ml Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: frasco c/ 1000ml 14 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS hipoclorito de sódio diluído, concentração contendo 2 a 2,5% de cloro ativo, forma farmacêutica solução aquosa estabilizada com cloreto de sódio, característica adicional embalagem com tampa rosqueável, frasco c/ 1000ml Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: Frasco c/ 1000ml 15 - LÂMINA BISTURI LÂMINA BISTURI, MATERIAL AÇO INOXIDÁVEL, TAMANHO Nº 11, TIPO DESCARTÁVEL, ESTERILIDADE ESTÉRIL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: CAIXA 100,00 UN 16 - LÂMINA BISTURI LÂMINA BISTURI, MATERIAL AÇO INOXIDÁVEL, TAMANHO Nº 12, TIPO DESCARTÁVEL, ESTERILIDADE ESTÉRIL, CARACTERÍSTICAS ADICIONAIS EMBALADA INDIVIDUALMENTE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: CAIXA 100,00 UN 17 - LÂMINA BISTURI LÂMINA BISTURI, MATERIAL AÇO CARBONO, TAMANHO Nº 15C, TIPO DESCARTÁVEL, ESTERILIDADE ESTÉRIL, CARACTERÍSTICAS ADICIONAIS EMBALADA INDIVIDUALMENTE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: CAIXA 100,00 UN 18 - LÂMINA BISTURI LÂMINA BISTURI, MATERIAL AÇO INOXIDÁVEL, TAMANHO Nº 15, TIPO DESCARTÁVEL, ESTERILIDADE ESTÉRIL, CARACTERÍSTICAS ADICIONAIS EMBALADA INDIVIDUALMENTE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: CAIXA 100,00 UN 19 - LÂMINA BISTURI LÂMINA BISTURI, MATERIAL AÇO INOXIDÁVEL, TAMANHO Nº 23, TIPO DESCARTÁVEL, ESTERILIDADE ESTÉRIL, CARACTERÍSTICAS ADICIONAIS EMBALADA INDIVIDUALMENTE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 12 Unidade de fornecimento: CAIXA 100,00 UN 20 - LAMÍNULA LAMÍNULA, MATERIAL VIDRO, DIMENSÕES CERCA DE 25 X 25 MM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: CAIXA 100,00 UN 21 - LAMÍNULA LAMÍNULA, MATERIAL VIDRO, DIMENSÕES CERCA DE 25 X 30 MM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: CAIXA 100,00 UN 22 - LAMÍNULA LAMÍNULA, MATERIAL VIDRO, DIMENSÕES CERCA DE 25 X 40 MM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 80 Unidade de fornecimento: CAIXA 100,00 UN 23 - LAMÍNULA LAMÍNULA, MATERIAL VIDRO, DIMENSÕES CERCA DE 25 X 50 MM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: CAIXA 100,00 UN 24 - LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO, MATERIAL PLÁSTICA, TAMANHO TAMANHO ÚNICO, CARACTERÍSTICAS ADICIONAIS EMBALAGEM INDIVIDUAL, ESTERILIDADE ESTÉRIL, TIPO USO DESCARTÁVEL, MODELO AMBIDESTRA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 400 Unidade de fornecimento: CAIXA 100,00 UN 25 - LUVA CIRÚRGICA LUVA CIRÚRGICA, MATERIAL LÁTEX NATURAL, TAMANHO 6,50, ESTERILIDADE ESTÉRIL, CARACTERÍSTICAS ADICIONAIS SEM PÓ, PUNHO LONGO COM BAINHA, APRESENTAÇÃO HIPOALERGÊNICA,ALTA RESISTÊNCIA E SENSIBILIDADE, TIPO USO DESCARTÁVEL, FORMATOANATÔMICO, APLICAÇÃO ANTIDERRAPANTE, EMBALAGEM DUPLA EMBALAGEM, ABERTURA ASSÉPTICA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 150 Unidade de fornecimento: PAR 26 - LUVA CIRÚRGICA LUVA CIRÚRGICA, MATERIAL LÁTEX NATURAL, TAMANHO 7, ESTERILIDADE ESTÉRIL, CARACTERÍSTICAS ADICIONAIS SEM PÓ, PUNHO LONGO COM BAINHA, APRESENTAÇÃO HIPOALERGÊNICA,ALTA RESISTÊNCIA E SENSIBILIDADE, TIPO USO DESCARTÁVEL, FORMATOANATÔMICO, APLICAÇÃO ANTIDERRAPANTE, EMBALAGEM DUPLA EMBALAGEM, ABERTURA ASSÉPTICA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 300 Unidade de fornecimento: PAR 27 - LUVA CIRÚRGICA LUVA CIRÚRGICA, MATERIAL LÁTEX NATURAL, TAMANHO 7,50, ESTERILIDADE ESTÉRIL, CARACTERÍSTICAS ADICIONAIS SEM PÓ, PUNHO LONGO COM BAINHA, APRESENTAÇÃO HIPOALERGÊNICA,ALTA RESISTÊNCIA E SENSIBILIDADE, TIPO USO DESCARTÁVEL, FORMATOANATÔMICO, APLICAÇÃO ANTIDERRAPANTE, EMBALAGEM DUPLA EMBALAGEM, ABERTURA ASSÉPTICA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 300 Unidade de fornecimento: PAR 28 - LUVA CIRÚRGICA LUVA CIRÚRGICA, MATERIAL LÁTEX NATURAL, TAMANHO 8, ESTERILIDADE ESTÉRIL, CARACTERÍSTICAS ADICIONAIS SEM PÓ, PUNHO LONGO COM BAINHA, APRESENTAÇÃO HIPOALERGÊNICA,ALTA RESISTÊNCIA E SENSIBILIDADE, TIPO USO DESCARTÁVEL, FORMATOANATÔMICO, APLICAÇÃO ANTIDERRAPANTE, EMBALAGEM DUPLA EMBALAGEM, ABERTURA ASSÉPTICA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 300 Unidade de fornecimento: PAR 29 - LUVA CIRÚRGICA LUVA CIRÚRGICA, MATERIAL LÁTEX NATURAL, TAMANHO 8,50, ESTERILIDADE ESTÉRIL, CARACTERÍSTICAS ADICIONAIS SEM PÓ, PUNHO LONGO COM BAINHA, APRESENTAÇÃO HIPOALERGÊNICA,ALTA RESISTÊNCIA E SENSIBILIDADE, TIPO USO DESCARTÁVEL, FORMATOANATÔMICO, APLICAÇÃO ANTIDERRAPANTE, EMBALAGEM DUPLA EMBALAGEM, ABERTURA ASSÉPTICA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 150 Unidade de fornecimento: PAR 30 - LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO, MATERIAL LÁTEX NATURAL ÍNTEGRO E UNIFORME, TAMANHO EXTRAPEQUENO, CARACTERÍSTICAS ADICIONAIS LUBRIFICADA COM PÓ BIOABSORVÍVEL, DESCARTÁVEL, APRESENTAÇÃO ATÓXICA, TIPO AMBIDESTRA, TIPO USO DESCARTÁVEL, MODELO FORMATO ANATÔMICO, FINALIDADE RESISTENTE À TRAÇÃO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: CAIXA 100,00 UN 31 - LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO, MATERIAL LÁTEX NATURAL ÍNTEGRO E UNIFORME, TAMANHO GRANDE, CARACTERÍSTICAS ADICIONAIS LUBRIFICADA COM PÓ BIOABSORVÍVEL, DESCARTÁVEL, APRESENTAÇÃO ATÓXICA, TIPO AMBIDESTRA, TIPO USO DESCARTÁVEL, MODELO FORMATO ANATÔMICO, FINALIDADE RESISTENTE À TRAÇÃO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: CAIXA 100,00 UN 32 - LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO, MATERIAL LÁTEX NATURAL ÍNTEGRO E UNIFORME, TAMANHO MÉDIO, CARACTERÍSTICAS ADICIONAIS LUBRIFICADA COM PÓ BIOABSORVÍVEL, DESCARTÁVEL, APRESENTAÇÃO ATÓXICA, TIPO AMBIDESTRA, TIPO USO DESCARTÁVEL, MODELO FORMATO ANATÔMICO, FINALIDADE RESISTENTE À TRAÇÃO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: CAIXA 100,00 UN 33 - LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO LUVA PARA PROCEDIMENTO NÃO CIRÚRGICO, MATERIAL LÁTEX NATURAL ÍNTEGRO E UNIFORME, TAMANHO PEQUENO, CARACTERÍSTICAS ADICIONAIS LUBRIFICADA COM PÓ BIOABSORVÍVEL, DESCARTÁVEL, APRESENTAÇÃO ATÓXICA, TIPO AMBIDESTRA, TIPO USO DESCARTÁVEL, MODELO FORMATO ANATÔMICO, FINALIDADE RESISTENTE À TRAÇÃO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 700 Unidade de fornecimento: CAIXA 100,00 UN 34 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Máscara cirúrgica, tipo não tecido,3 camadas,pregas horizontais,atóxica, tipo fixação com elástico, características adicionais clip nasal embutido,hipoalergênica, tipo uso descartável, cx c/ 50 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: Caixa c/ 50 unidades 35 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS máscara cirúrgica, tipo não tecido,3 camadas,pregas horizontais,atóxica, tipo fixação 4 tiras laterais p/ fixação, características adicionais clip nasal embutido,hipoalergênica, cor branca, tipo uso descartável, pacote c/ 100 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: PACOTE 100 unidades 36 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Navalha laboratório, material aço inox, revestimento revestida com cerâmica e ptfe, aplicação para micrótomo, dimensões cerca de 80 x 14, adicional alto perfil, tipo uso descartável, cx c/ 50 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: Caixa c/ 50 unidades 37 - PAPEL GRAU CIRÚRGICO PAPEL GRAU CIRÚRGICO, CARACTERÍSTICAS ADICIONAIS C/ INDICADOR QUÍMICO, LARGURA10 CM, COMPRIMENTO 100 M, APLICAÇÃO EMBALAR MATERIAL PARA ESTERILIZAÇÃO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: ROLO 100,00 M 38 - PAPEL GRAU CIRÚRGICO PAPEL GRAU CIRÚRGICO, CARACTERÍSTICAS ADICIONAIS TRIPLA LINHA DE SELAGEM E INDICADOR DE PROCESSO, LARGURA 30 CM, COMPRIMENTO 100 M, MATERIAL EM POLIÉSTERC/FILME DE POLIPROPILENO, GRAMATURA 70G/M²(PAPEL),60G/M²(FILME) G/M2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 40 Unidade de fornecimento: ROLO 100,00 M 39 - PAPEL GRAU CIRÚRGICO PAPEL GRAU CIRÚRGICO, LARGURA 45 CM, COMPRIMENTO 100 M Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 60 Unidade de fornecimento: ROLO 100,00 M 40 - TOALHA DE PAPEL TOALHA DE PAPEL, MATERIAL PAPEL ALTA ALVURA, TIPO FOLHA 3 DOBRAS, COMPRIMENTO 26 CM, LARGURA 20 CM, COR BRANCA, CARACTERÍSTICAS ADICIONAIS INTERFOLHADA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1200 Unidade de fornecimento: PACOTE 1.250,00 FL 41 - IODOPOVIDONA (PVPI) IODOPOVIDONA (PVPI), CONCENTRAÇÃO A 10% ( TEOR DE IODO 1% ), FORMA FARMACEUTICA SOLUÇÃO TÓPICA AQUOSA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: FRASCO 1,00 L 42 - CLOREXIDINA DIGLUCONATO CLOREXIDINA DIGLUCONATO, DOSAGEM 2%, APLICAÇÃO DEGERMANTE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: FRASCO 1.000,00 ML 43 - SACO PLÁSTICO LIXO SACO PLÁSTICO LIXO, CAPACIDADE 100 L, COR BRANCO LEITOSO, CARACTERÍSTICAS ADICIONAIS COM SIMBOLOGIA DE SUBSTÂNCIA INFECTANTE, NORMAS TÉCNICAS NBR 7500, NBR 9191, MATERIAL POLIETILENO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: PACOTE 100,00 UN 44 - SACO PLÁSTICO LIXO SACO PLÁSTICO LIXO, CAPACIDADE 15 L, COR BRANCO LEITOSO, LARGURA 39 CM, ALTURA58 CM, CARACTERÍSTICAS ADICIONAIS COM SIMBOLOGIA DE SUBSTÂNCIA INFECTANTE, APLICAÇÃO COLETA DE RESÍDUOS DE SERVIÇOS DE SAÚDE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1600 Unidade de fornecimento: PACOTE 100,00 UN 45 - SACO SACO, MATERIAL POLIETILENO VIRGEM, TIPO USO LABORATORIAL, COR BRANCA, CAPACIDADE 30 L, APLICAÇÃO COLETA LIXO NÃO RECICLÁVEL P/ RESÍDUOS INFECTANTE S, CARACTERÍSTICAS ADICIONAIS SISTEMA DE FECHAMENTO COM LACRE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 500 Unidade de fornecimento: PACOTE 100,00 UN 46 - SACO PLÁSTICO LIXO SACO PLÁSTICO LIXO, CAPACIDADE 50 L, COR BRANCO LEITOSO, LARGURA 53 CM, ALTURA80 CM, CARACTERÍSTICAS ADICIONAIS PEÇA ÚNICA/SUPORTA 10KG/IDENTIFICADO/ ETIQUETADO, ESPESSURA 0,08 MM, APLICAÇÃO COLETA DE RESÍDUOS INFECTANTES, MATERIAL POLIETILENO ALTA DENSIDADE Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: PACOTE 100,00 UN 47 - SERINGA SERINGA, MATERIAL AÇO INOXIDÁVEL, TIPO USO AUTOCLAVÁVEL, CAPACIDADE 1,80 ML, CARACTERÍSTICAS ADICIONAIS RETROCARGA, TIPO CARPULE, APLICAÇÃO ASPIRAÇÃO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: UNIDADE 48 - SERINGA SERINGA, MATERIAL POLIPROPILENO TRANSPARENTE, CAPACIDADE 1 ML, CARACTERÍSTICASADICIONAIS COM SISTEMA SEGURANÇA SEGUNDO NR/32, GRADUAÇÃO IMPRESSÃO LEGÍVEL E PERMANENTE, TIPO USO GRADUAÇÃO MÁXIMA 0,2 EM 0,2 ML, NUMERADA, COMPONENTE C/ AGULHA 13 X 0,38 MM, BISEL TRIFACETADO, TIPO TAMPA PROTETOR PLÁSTICO, ESTERILIDADE DESCARTÁVEL,ESTÉRIL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 120 Unidade de fornecimento: UNIDADE 49 - SERINGA SERINGA, MATERIAL POLIPROPILENO TRANSPARENTE, CAPACIDADE 10 ML, TIPO BICO BICOLUER LOCK, CARACTERÍSTICAS ADICIONAIS ISENTA DE LÁTEX,ATÓXICA,APIROGÊNICA, GRADUAÇÃO MARCAS PARABÓLICAS EM 3,6 E 10ML, TIPO USO PERDA DE RESISTÊNCIA, ESTERILIDADE DESCARTÁVEL,ESTÉRIL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 600 Unidade de fornecimento: UNIDADE 50 - SERINGA SERINGA, MATERIAL POLIPROPILENO TRANSPARENTE, CAPACIDADE 3 ML, TIPO BICO BICO CENTRAL SIMPLES OU LUER LOCK, CARACTERÍSTICAS ADICIONAIS ÊMBOLO C/ROLHA BORRACHA, GRADUAÇÃO IMPRESSÃO LEGÍVEL E PERMANENTE, TIPO USO GRADUAÇÃO MÁXIMA 0,2 EM 0,2 ML, NUMERADA, COMPONENTE C/ AGULHA 20 X 0,55 MM, BISEL TRIFACETADO,TIPO TAMPA PROTETOR PLÁSTICO, ESTERILIDADE DESCARTÁVEL,ESTÉRIL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: UNIDADE 51 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Indicador biológico, tipo terceira geração, apresentação autocontido, ampola com meio de cultura, espécie bacillus stearothermophillus, características adicionais resposta em 48 horas, aplicação para esterilização a vapor, componentes adicionais com indicador químico e controle de processo, adicionais pacote para teste, cx c/ 10 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: Caixa c/ 10 unidades 52 - CLORETO DE SÓDIO CLORETO DE SÓDIO, PRINCÍPIO ATIVO 0,9%_ SOLUÇÃO INJETÁVEL, APLICAÇÃO SISTEMA FECHADO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1000 Unidade de fornecimento: FRASCO 250,00 ML 53 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Touca descartável uso hospitalar, tipo formato anatômico, gramatura 20, cor branca, tamanho tamanho único, material fibras de polipropileno, características adicionais elástico em toda a volta, pct c/ 100 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 300 Unidade de fornecimento: PACOTE 00000100,00 U 54 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Gorro descartável, tipo tiras, gramatura 30, material não tecido, pct c/ 100 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 150 Unidade de fornecimento: PACOTE 00000100,00 U 55 - SERINGA SERINGA, MATERIAL POLIPROPILENO TRANSPARENTE, CAPACIDADE 50 ML, TIPO BICO BICOLATERAL LUER SLIP, CARACTERÍSTICAS ADICIONAIS ÊMBOLO COM PONTEIRA DE BORRACHA SILICONIZADA, GRADUAÇÃO GRADUAÇÃO FIRME E PERFEITAMENTE LEGÍVEL, TIPO USO DESCARTÁVEL, ESTÉRIL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2000 Unidade de fornecimento: UNIDADE 56 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Seringa, material polipropileno transparente, capacidade 20, tipo bico bico luer lock, características adicionais compatível c/bomba infusomat, graduação graduada de 1 em 1ml, componente analgesia controlada pelo paciente, esterilidade descartável,estéril, modelo perfusora cx c/ 100 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: CAIXA 00000100,00 UN 57 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Acetona, aspecto físico líquido límpido transparente, fórmula química c3h6o, massa molecular 58,08, grau de pureza pureza mínima de 99,5%, característica adicional reagente p.a., número de referência química cas 67-64-1, frasco c/ 1 litro Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 14 Unidade de fornecimento: Frasco c/ 1 litro 58 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Ácido cítrico, aspecto físico cristal incolor, inodoro, sabor ácido agradável, fórmula química c6h8o7 anidro, peso molecular 192,12, pureza mínima pureza mínima de 99,5%, característica adicional reagente p.a. acs, número de referência química* cas 77-92-9, frasco c/ 500g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: Frasco 500g 59 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Ácido fluorídrico, aspecto físico líquido incolor, fumegante, odor ácido, peso molecular 20,01, fórmula química hf, teor de pureza teor mínimo de 48%, característica adicional reagente p.a. acs iso, número de referência química cas 7664-39-3, frasco c/ 1000ml Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: Frasco c/ 1000ml 60 - ÁCIDO FÓRMICO ÁCIDO FÓRMICO, ASPECTO FÍSICO LÍQUIDO INCOLOR, ODOR PENETRANTE, COMPOSIÇÃO QUÍMICA HCOOH, PESO MOLECULAR 46,03 G/MOL, TEOR DE PUREZA TEOR MÍNIMO DE 85%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 64- 18-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 61 - MEIO DE CULTURA MEIO DE CULTURA, TIPO ÁGAR INFUSO DE CÉREBRO E CORAÇÃO (BHI), APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: FRASCO 500,00 G 62 - MEIO DE CULTURA. MEIO DE CULTURA., TIPO ÁGAR MITIS SALIVARIUS, ASPECTO FÍSICO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: FRASCO 500,00 G 63 - PERÓXIDO DE HIDROGÊNIO (ÁGUA OXIGENADA) PERÓXIDO DE HIDROGÊNIO (ÁGUA OXIGENADA), TIPO 10 VOLUMES Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 400 Unidade de fornecimento: FRASCO 1.000,00 ML 64 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Alça bacteriológica, material* plástico, componentes com haste flexível, calibragem calibrada, volume 10 mcl, esterilidade estéril, descartável, embalagem embalagem individual, pct c/ 100 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: PACOTE 100 unidades 65 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, TIPO HIDRATADO, TEOR ALCOÓLICO 70%_(70¨GL), APRESENTAÇÃO LÍQUIDO Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1400 Unidade de fornecimento: FRASCO 1.000,00 ML 66 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, TIPO HIDRATADO, TEOR ALCOÓLICO 70%_(70¨GL), APRESENTAÇÃO GEL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: FRASCO 1.000,00 ML 67 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, TEOR ALCOÓLICO 95,1 A 96¨GL, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/MOL, GRAU DE PUREZA 92,6% A 93,8% P/P INPM, CARACTERÍSTICA ADICIONAL HIDRATADO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-17-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 640 Unidade de fornecimento: LITRO 68 - ÁLCOOL ETÍLICO ÁLCOOL ETÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, VOLÁTIL, TEOR ALCOÓLICO MÍNIMO DE 99,5¨GL, FÓRMULA QUÍMICA C2H5OH, PESO MOLECULAR 46,07 G/ MOL, GRAU DE PUREZA MÍNIMO DE 99,7% P/P INPM, CARACTERÍSTICA ADICIONAL ANIDRO,ABSOLUTO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 64-17-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 86 Unidade de fornecimento: LITRO 69 - ÁLCOOL METÍLICO ÁLCOOL METÍLICO, ASPECTO FÍSICO LÍQUIDO LÍMPIDO, INCOLOR, ODOR CARACTERÍSTICO,FÓRMULA QUÍMICA CH3OH, PESO MOLECULAR 32,04 G/MOL, GRAU DE PUREZA PUREZA MÍNIMA DE 99,8%, CARACTERÍSTICA ADICIONAL REAGENTE P.A., NÚMERO DE REFERÊNCIA QUÍMICA CAS 67-56-1 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 24 Unidade de fornecimento: LITRO 70 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Dicromato de potássio, aspecto físico pó fino, cristalino, cor laranja, composição química k2cr2o7, peso molecular 294,18, grau de pureza pureza mínima de 99%, característica adicional reagente p.a., número de referência química cas 7778-50-9, frasco c/ 500g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Frasco 500g 71 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Bissulfito de sódio, aspecto físico pó branco cristalino, fórmula química nahso3, peso molecular 104,06, grau de pureza teor de (so2) mínimo de 58,5%, característica adicional reagente p.a., número de referência química cas 7631-90-5, frasco c/ 500g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Frasco 500g 72 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Citrato de sódio, aspecto físico cristal fino, composição c6h5na3o7.2h2o, peso molecular 294,10, grau de pureza pureza mínima de 99%, características adicionais reagente p.a., número de referência química cas 6132-04-3, frasco c/ 500g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 12 Unidade de fornecimento: Frasco 500g 73 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Cloreto de sódio, aspecto físico pó cristalino branco ou cristais incolores, composição química nacl anidro, peso molecular 58,45, pureza mínima pureza mínima de 99,5%, característica adicional reagente p.a., número de referência química cas 7647-14-5, frasco c/ 500g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Frasco 500g 74 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Microtubo, material polipropileno, capacidade 1,8, graduação graduado, tipo tampa tampa rosqueável, tipo fundo fundo redondo, esterilidade estéril, tipo* criogênico, pct c/ 100 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: PACOTE 100 unidades 75 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Ácido etilenodiaminotetracético (edta), aspecto físico pó branco cristalino, peso molecular 372,24, fórmula química c10h14n2o8na2.2h2o (sal dissódico dihidratado), grau de pureza pureza mínima de 99%, característica adicional reagente p.a., número de referência química cas 6381-92-6, frasco c/ 500g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: Frasco 500g 76 - SUPLEMENTO PARA MEIO DE CULTURA SUPLEMENTO PARA MEIO DE CULTURA, TIPO EMULSÃO DE GEMA DE OVO, ASPECTO FÍSICO LÍQUIDO, CARACTERÍSTICAS ADICIONAIS ESTÉRIL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: FRASCO 100,00 ML 77 - CORANTE CORANTE, TIPO EOSINA AMARELADA Y, ASPECTO FÍSICO PÓ, CARACTERÍSTICAS ADICIONAIS CI 45380 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: FRASCO 25,00 G 78 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Filtro laboratório, tipo para seringa, material nylon, porosidade 0,22 m, dimensões cerca de 25, esterilidade estéril, apirogênico, tipo uso descartável, embalagem embalagem individual, caixa c/ 25 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: Caixa c/ 25 unidades 79 - FORMALDEÍDO (FORMOL) FORMALDEÍDO (FORMOL), ASPECTO FÍSICO LÍQUIDO INCOLOR, LÍMPIDO, FÓRMULA QUÍMICAH2CO, PESO MOLECULAR 30,03 G/MOL, GRAU DE PUREZA CONCENTRAÇÃO MÍNIMA DE 36,5%,CARACTERISTICA ADICIONAL REAGENTE P.A. ACS, NÚMERO DE REFERÊNCIA QUÍMICA CAS 50-00-0 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: LITRO 80 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS fosfato de sódio, aspecto físico pó fino de cristais brancos, inodoro, higroscópico, fórmula química na2hpo4.7h2o (bibásico heptahidratado), massa molecular 268,07, grau de pureza pureza mínima de 99%, característica adicional reagente p.a. acs, número de referência química cas 7782-85-6, frasco c/ 1000g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: Frasco c/ 1000g 81 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Fosfato de sódio, aspecto físico pó fino de cristais brancos, inodoro, higroscópico, fórmula química nah2po4 (monobásico anidro), massa molecular 119,98, grau de pureza pureza mínima de 98%, característica adicional reagente p.a., número de referência química cas 7558-80-7, frasco c/ 500g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: Frasco 500g 82 - CORANTE CORANTE, TIPO FUCSINA BÁSICA, ASPECTO FÍSICO PÓ, CARACTERÍSTICAS ADICIONAIS CI42510 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: FRASCO 100,00 G 83 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Glicerina p.a. frasco c/ 1 litro Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: Frasco c/ 1 litro 84 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Glicina, aspecto físico cristal branco, inodoro, peso molecular 75,07, fórmula química c2h5no2, grau de pureza pureza mínima de 98,5%, característica adicional reagente p.a., número de referência química cas 56-40-6, frasco c/ 500g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: Frasco 500g 85 - ESTANTE PARA MICROTUBOS ESTANTE PARA MICROTUBOS, MATERIAL POLIPROPILENO, CAPACIDADE 80 TUBOS, TAMANHO PARA TUBOS 1 ML A 2 ML, COMPONENTES COM TAMPA, ADICIONAL IDENTIFICAÇÃO ALFANUMÉRICA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 40 Unidade de fornecimento: UNIDADE 86 - CAIXA LABORATÓRIO CAIXA LABORATÓRIO, MATERIAL POLIPROPILENO, CAPACIDADE 96 PONTEIRAS, VOLUME PARA PONTEIRA 200 MCL, ACESSÓRIOS TAMPA COM DOBRADIÇA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: UNIDADE 87 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Caixa laboratório, material polipropileno, capacidade 96 ponteiras, volume para ponteira 1000UL, acessórios tampa com dobradiça, característica adicional ponteira azul Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: UNIDADE 88 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Hack para 50 tubos criogêniocos c/ tampa, capacidade 1,5 - 2ml Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 12 Unidade de fornecimento: UNIDADE 89 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Parafina, aspecto físico histológica, sólida, branca, apresentação em pó, pacote c/ 1 kg Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: Pacote 1 kg 90 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Lâmina laboratório, material vidro, aplicação para imunofluorescência, dimensões cerca de 75 x 25, tipo borda borda fosca, adicional com 1 área, cx c/ 50 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 200 Unidade de fornecimento: Caixa c/ 50 unidades 91 - REAGENTE ANALÍTICO REAGENTE ANALÍTICO, COMPOSIÇÃO LAURIL SULFATO DE SÓDIO, CONCENTRAÇÃO SOLUÇÃO A2% Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: FRASCO 500,00 G 92 - REAGENTE ANALÍTICO. REAGENTE ANALÍTICO., TIPO PARA MONTAGEM LÂMINAS, ASPECTO FÍSICO SOLUÇÃO AQUOSA, ADICIONAL PARA ENSAIOS FLUORESCENTES Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: FRASCO 100,00 ML 93 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS ácido 3-n-morfolino propansulfônico (mops), aspecto físico pó branco, fórmula química c7h15no4s, peso molecular 209,27, teor de pureza pureza mínima de 99%, característica adicional reagente p.a, número de referência química cas 1132-61-2, frasco c/ 100g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: Frasco 100g 94 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS Pastilha para Cultivo em Anaerobiose tipo Probac caixa c/ 10 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: Caixa c/ 10 unidades 95 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS perborato de sódio, aspecto físico pó ou grânulo branco, cristalino, inodoro, fórmula química nabo3 anidro, peso molecular 81,80, teor de pureza pureza mínima de 98%, número de referência química cas 7632-04-4, frasco c/ 100g Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: Frasco 100g 96 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS placa de petri, material vidro, formato redonda, dimensões cerca de 20 x 100, caixa c/ 10 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: Caixa c/ 10 unidades 97 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS placa de petri, material plástico, formato redonda, dimensões cerca de 15 x 100, esterilidade estéril, tipo uso descartável, caixa c/ 10 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: Caixa c/ 10 unidades 98 - EQUIPAMENTOS DIVERSOS PARA SERVIÇOS PROFISSIONAIS placa de petri, material plástico, formato redonda, dimensões cerca de 15 x 90, esterilidade estéril, tipo uso descartável, caixa c/ 10 unidades Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 100 Unidade de fornecimento: Caixa c/ 10 unidades 99 - PLACA LABORATÓRIO PLACA LABORATÓRIO, TIPO PARA CULTURA, MATERIAL PLÁSTICO, CAPACIDADE 96 POÇOS, TIPO FUNDO FUNDO CHATO, COMPONENTES COM MEMBRANA ÉSTERES DE CELULOSE,0,45 µM, ESTERILIDADE* ESTÉRIL, APIROGÊNICA, LIVRE DE DNASE E RNASE, TIPO USO* DESCARTÁVEL, EMBALAGEM PRIMÁRIA EMBALAGEM INDIVIDUAL Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 40 Unidade de fornecimento: UNIDADE 100 - MEIO DE CULTURA MEIO DE CULTURA, TIPO CALDO SABOURAUD DEXTROSE 2%, APRESENTAÇÃO LÍQUIDO, CARACTERÍSTICA ADICIONAL TUBO PADRÃO 16X150MM Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: FRASCO 500,00 G

Electronic Auction - Purchase of chemical material, supplies, tools and safety equipment.

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO, Empresa Brasileira de Pesquisa Agropecuária, Embrapa/CPACT, | Published July 13, 2015

1 - IPRODIONA IPRODIONA, CONCENTRAÇÃO 50% P/V, APRESENTAÇÃO SUSPENSÃO CONCENTRADA, NÚMERO DEREFERÊNCIA QUÍMICA CAS 36734-19-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 2 - DICLORANA DICLORANA, CONCENTRAÇÃO 75% P/P, FORMA FÍSICA PÓ MOLHÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 99-30-9 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: QUILOGRAMA 3 - DICARBOXIMIDA DICARBOXIMIDA, CONCENTRAÇÃO 50% P/P, FORMA FÍSICA PÓ MOLHÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 50471-44-8 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 4 - DELTAMETRINA DELTAMETRINA, CONCENTRAÇÃO 2,5% P/V, APRESENTAÇÃO CONCENTRADO EMULSIONÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 52918-63-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 5 - MANCOZEBE MANCOZEBE, CONCENTRAÇÃO 80% P/P, APRESENTAÇÃO PÓ MOLHÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 8018-01-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: QUILOGRAMA 6 - GLIFOSATO GLIFOSATO, COMPOSIÇÃO SAL POTÁSSICO, CONCENTRAÇÃO 62% P/V, APRESENTAÇÃO CONCENTRADO SOLÚVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1071-83-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: LITRO 7 - FERTILIZANTE UREIA FERTILIZANTE UREIA, COMPOSIÇÃO QUÍMICA NITROGÊNIO 46 PER, APRESENTAÇÃO GRANULADO, COR BRANCA, PRAZO VALIDADE 36 MÊS, APLICAÇÃO PLANTIO, CARACTERÍSTICAS ADICIONAIS HIGROSCÓPIA/SOLÚVEL ÁGUA/ÁLCOOL E BENZINA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: SACO 50,00 KG 8 - ADUBO QUÍMICO ADUBO CLORETO DE POTÁSSIO, 00-00-60 SACO COM 50KG. BR 72010 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: SACO 50,00 KG 9 - TESOURA PODA TESOURA DE PODAR DE DUAS MÃOS, COMPRIMENTO 60 CM - CABEÇA DE CORTE TIRANTE, REF. MODELO FELCO 210C-60 - VERDE, BR 3689 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: UNIDADE 10 - TESOURA PODA TESOURA DE PODA DE IGUAL OU MELHOR QUALIDADE QUE A REFERÊNCIA MARCA FELCO Nº 2. BR 3689 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: UNIDADE 11 - FERTILIZANTE UREIA FERTILIZANTE UREIA, COMPOSIÇÃO QUÍMICA NITROGÊNIO 46 PER, APRESENTAÇÃO GRANULADO, COR BRANCA, PRAZO VALIDADE 36 MÊS, APLICAÇÃO PLANTIO, CARACTERÍSTICAS ADICIONAIS HIGROSCÓPIA/SOLÚVEL ÁGUA/ÁLCOOL E BENZINA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: SACO 50,00 KG 12 - ADUBO QUÍMICO ADUBO SUPERFOSFATO TRIPLO 00-42-00 SACO COM 50KG. BR 72010 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: SACO 50,00 KG 13 - ADUBO QUÍMICO ADUBO FORMULA 05-20-20 SACO COM 50KG. BR 72010 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: SACO 50,00 KG 14 - ADUBO QUÍMICO ADUBO SULFATO DE AMÔNIA, 15% DE NITROGÊNIO E 17 a 22% DE ENXOFRE, SACO DE 50 KG, BR 72010 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 30 Unidade de fornecimento: SACO 50,00 KG 15 - TEBUCONAZOL TEBUCONAZOL, CONCENTRAÇÃO 20% P/V, APRESENTAÇÃO CONCENTRADO EMULSIONÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 107534-96-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 16 - OXICLORETO DE COBRE OXICLORETO DE COBRE, CONCENTRAÇÃO 50% P/P, APRESENTAÇÃO PÓ MOLHÁVEL, NÚMERO DEREFERÊNCIA QUÍMICA CAS 1332-40-7 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 17 - DELTAMETRINA DELTAMETRINA, CONCENTRAÇÃO 5% P/V, APRESENTAÇÃO SUSPENSÃO CONCENTRADA, NÚMERO DE REFERÊNCIA QUÍMICA CAS 52918-63-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 18 - DELTAMETRINA DELTAMETRINA, CONCENTRAÇÃO 2,5% P/V, APRESENTAÇÃO CONCENTRADO EMULSIONÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 52918-63-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 19 - SULFLURAMIDA SULFLURAMIDA, CONCENTRAÇÃO 0,2% P/P, APRESENTAÇÃO GRANULADO, NÚMERO DE REFERÊNCIA QUÍMICA CAS 4151-50-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 50 Unidade de fornecimento: QUILOGRAMA 20 - FIPRONIL FIPRONIL, CONCENTRAÇÃO 20% P/V, APRESENTAÇÃO SUSPENSÃO CONCENTRADA, NÚMERO DE REFERÊNCIA QUÍMICA CAS 120068-37-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 400 Unidade de fornecimento: MILILITRO 21 - FIPRONIL FIPRONIL, CONCENTRAÇÃO 25% P/V, APRESENTAÇÃO SUSPENSÃO CONCENTRADA, NÚMERO DE REFERÊNCIA QUÍMICA CAS 120068-37-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: QUILOGRAMA 22 - CAPTANA CAPTANA, CONCENTRAÇÃO 50% P/P, APRESENTAÇÃO PÓ MOLHÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 133-06-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 10 Unidade de fornecimento: LITRO 23 - TEBUCONAZOL TEBUCONAZOL, CONCENTRAÇÃO 20% P/V, APRESENTAÇÃO CONCENTRADO EMULSIONÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 107534-96-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: LITRO 24 - DELTAMETRINA DELTAMETRINA, CONCENTRAÇÃO 2,5% P/V, APRESENTAÇÃO CONCENTRADO EMULSIONÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 52918-63-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: LITRO 25 - DIMETOATO DIMETOATO, CONCENTRAÇÃO 40% P/V, FORMA FÍSICA CONCENTRADO EMULSIONÁVEL, NÚMERODE REFERÊNCIA QUÍMICA CAS 60-51-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: LITRO 26 - ADUBO QUÍMICO ADUBO FÓRMULA NPK 08-28-12 SACO DE 50 KG. BR 72010 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15 Unidade de fornecimento: SACO 50,00 KG 27 - FERTILIZANTE UREIA FERTILIZANTE UREIA, COMPOSIÇÃO QUÍMICA NITROGÊNIO 46 PER, APRESENTAÇÃO GRANULADO, COR BRANCA, PRAZO VALIDADE 36 MÊS, APLICAÇÃO PLANTIO, CARACTERÍSTICAS ADICIONAIS HIGROSCÓPIA/SOLÚVEL ÁGUA/ÁLCOOL E BENZINA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 15 Unidade de fornecimento: SACO 50,00 KG 28 - ADUBO QUÍMICO ADUBO SUPERFOSFATO SIMPLES SACO COM 50KG. BR 72010 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 3 Unidade de fornecimento: SACO 50,00 KG 29 - ADUBO QUÍMICO ADUBO CLORETO DE POTÁSSIO, 00-00-60 SACO COM 50KG. BR 72010 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: SACO 50,00 KG 30 - ADUBO QUÍMICO ADUBO SULFATO DE AMÔNIA, 15% DE NITROGÊNIO E 17 a 22% DE ENXOFRE, SACO DE 50 KG, BR 72010 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: SACO 50,00 KG 31 - PARAQUATE PARAQUATE, COMPOSIÇÃO SAL DICLORETO, CONCENTRAÇÃO 20% P/V, APRESENTAÇÃO CONCENTRADO SOLÚVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1910-42-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 5 Unidade de fornecimento: LITRO 32 - FIPRONIL FIPRONIL, CONCENTRAÇÃO 2,5% P/P, APRESENTAÇÃO CONCENTRADO EMULSIONÁVEL, NÚMERODE REFERÊNCIA QUÍMICA CAS 120068-37-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 33 - AZOXISTROBINA AZOXISTROBINA, COMPOSIÇÃO ASSOCIADA AO DIFENOCONAZOL, CONCENTRAÇÃO 20% + 12,5%P/V, APRESENTAÇÃO SUSPENSÃO CONCENTRADA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 34 - CAPTANA CAPTANA, CONCENTRAÇÃO 50% P/P, APRESENTAÇÃO PÓ MOLHÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 133-06-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 35 - CAPTANA CAPTANA, CONCENTRAÇÃO 50% P/P, APRESENTAÇÃO PÓ MOLHÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 133-06-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 36 - CAPTANA CAPTANA, CONCENTRAÇÃO 50% P/P, APRESENTAÇÃO PÓ MOLHÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 133-06-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 37 - DELTAMETRINA DELTAMETRINA, CONCENTRAÇÃO 2,5% P/V, APRESENTAÇÃO CONCENTRADO EMULSIONÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 52918-63-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 1 Unidade de fornecimento: LITRO 38 - FOSMETE FOSMETE, CONCENTRAÇÃO 50% P/P, FORMA FÍSICA PÓ MOLHÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 732-11-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: QUILOGRAMA 39 - TEBUCONAZOL TEBUCONAZOL, CONCENTRAÇÃO 20% P/V, APRESENTAÇÃO CONCENTRADO EMULSIONÁVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 107534-96-3 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: LITRO 40 - PARAQUATE PARAQUATE, COMPOSIÇÃO SAL DICLORETO, ASSOCIADO AO DIUROM, CONCENTRAÇÃO 20% + 10% P/V, APRESENTAÇÃO SUSPENSÃO CONCENTRADA Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 20 Unidade de fornecimento: LITRO 41 - DIMETOATO DIMETOATO, CONCENTRAÇÃO 40% P/V, FORMA FÍSICA CONCENTRADO EMULSIONÁVEL, NÚMERODE REFERÊNCIA QUÍMICA CAS 60-51-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 4 Unidade de fornecimento: LITRO 42 - MALATIONA MALATIONA, CONCENTRAÇÃO 44% P/V, APRESENTACÃO CONCENTRADO EMULSIONÁVEL, NÚMERODE REFERÊNCIA QUÍMICA CAS 121-75-5 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: LITRO 43 - VESTUÁRIO PROTEÇÃO KIT EPI - EQUIPAMENTO DE PROTEÇÃO INDIVIDUAL(CALÇA DE TECIDO HIDROREPELENTE, VISEIRA PARA PROTEÇÃO FACIAL, JALECO DE MANGA COMPRIDA, TOUCA ÁRABE, AVENTAL, LUVAS DE NITRILA E RESPIRADOR TAMANHO G. BR 150407 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 6 Unidade de fornecimento: Kit 44 - CALCÁRIO DOLOMITICO CALCÁRIO DOLOMITICO, ASPECTO FÍSICO PÓ, COMPOSIÇÃO PRNT ACIMA DE 80% Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 12 Unidade de fornecimento: SACO 50,00 KG 45 - FERTILIZANTE NATURAL FERTILIZANTE FOLIAR, MINERAL MISTO, SÓLIDO, FORMULAÇÃO WG, COMPOSTO DOS MICRONUTRIENTES BORO 0,7%, COBRE 0,3%, FERRO 7,5%, MANGANÊS 3,4%, MOLIBDÊNIO 0,1% E ZINCO 0,6% QUELATADOS COM EDTA - REFERÊNCIA COMERCIAL MICROMIX - RIGRANTEC. BR 5339 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 2 Unidade de fornecimento: kg 46 - FERTILIZANTE NATURAL FERTILIZANTE NATURAL, COMPOSIÇÃO QUÍMICA 17% P2O5 E 7% MG, APLICAÇÃO AGRICULTURA, TIPO TERMOFOSFATO MAGNESIANO, APRESENTAÇÃO PÓ Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 560 Unidade de fornecimento: QUILOGRAMA 47 - SULFLURAMIDA SULFLURAMIDA, CONCENTRAÇÃO 0,3% P/P, APRESENTAÇÃO ISCA GRANULADA, NÚMERO DE REFERÊNCIA QUÍMICA CAS 4151-50-2 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 8 Unidade de fornecimento: QUILOGRAMA 48 - GLIFOSATO GLIFOSATO, COMPOSIÇÃO SAL POTÁSSICO, CONCENTRAÇÃO 62% P/V, APRESENTAÇÃO CONCENTRADO SOLÚVEL, NÚMERO DE REFERÊNCIA QUÍMICA CAS 1071-83-6 Tratamento Diferenciado: - Aplicabilidade Decreto 7174: Não Aplicabilidade Margem de Preferência: Não Quantidade: 30 Unidade de fornecimento: LITRO

Electronic Auction - Purchase of chemical material, supplies, tools and safety.

MINISTÉRIO DA AGRICULTURA, PECUÁRIA E ABASTECIMENTO, Empresa Brasileira de Pesquisa Agropecuária, Embrapa/CPACT, | Published June 10, 2015

1 - SCISSORS PRUNING BR 3689 Differential Treatment: - Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit of supply: Unit 2 - SAW PRUNING