Call +44 800 9755 164

Public tenders for chemical in Ananindeua Brazil

Find all Chemical tenders in the world.
Finding business opportunities has never been easier.

Results for chemical. Make a new search!

Electronic Auction - laboratory equipment acquisition as primers, chemical materials, primers and kits

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published September 9, 2016

1 - FEEDER QUIMICO bottle with 50 l. (Item 01 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: BOTTLE 2 - FEEDER QUIMICO bottle with 25 l. (Item 02 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: BOTTLE 3 - FEEDER QUIMICO bottle with 25 l. (Item 03 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: BOTTLE 4 - FEEDER QUIMICO bottle with 160μl. (Item 04 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: BOTTLE 5 - FEEDER QUIMICO bottle with 160μl. (Item 05 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: BOTTLE 6 - FEEDER QUIMICO bottle with 200 mg / 1 ml. (Item 06 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 5 Unit Supply: BOTTLE 7 - FEEDER QUIMICO bottle with 200 mg / 1 ml. (Item 07 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 5 Unit Supply: BOTTLE 8 - FEEDER QUIMICO bottle with 200 mg / 1 ml (Item 08 SAMAM 033/2016) Treatment differentiated: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 5 Unit supply: 9 BOTTLE - FEEDER QUIMICO bottle with 200 mg / 1 ml. (Item 09 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 5 Unit Supply: BOTTLE 10 - FEEDER QUIMICO bottle with 10 ml. (Item 10 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 20 Unit Supply: BOTTLE 11 - FEEDER QUIMICO Kit containing 3 bottles (Taq enzyme, buffer and MgSO4) (Item 11 SAMAM 033/2016) Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 50 Unit supply: KIT 12 - FEEDER QUIMICO Life or similar (Item 12 SAMAM 033/2016) Differential Treatment: - Applicability Decree 7174 Do not Applicability Margin of Preference: No Number: 8 Unit of supply: KIT 13 - FEEDER QUIMICO Package with 20 units. (Item 13 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 30 Unit Supply: PACKAGE 14 - FEEDER QUIMICO weak for 100 applications (Item 14 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 5 Unit supply: bOTTLE 15 - FEEDER QUIMICO dye Oil Red O (C26H24N4O, MW 408.49) powder flask with 25g, Sigma-Aldrich brand, (No. catalog: O0625-25G) or similar (Item 15 SAMAM 033/2016) Treatment Differential: -. Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit supply: BOTTLE 16 - FEEDER QUIMICO Dye Red Alizarin S ( C14H7NaO7S, PM 342.26) powder flask with 25g, Sigma-Aldrich Brand (catalog no: A5533-25G). (Item 16 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit Supply: BOTTLE 17 - FEEDER QUIMICO Dye Blue Alcian 8GX (C56H68Cl4CuN16S4, PM 1298.86) powder, with bottle 25g, Sigma-Aldrich Brand (No. catalog: A3157-25G). (Item 17 SAMAM 033/2016) Treatment Differential: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit Supply: BOTTLE 18 - FEEDER QUIMICO Packaged in bottle with screw cap; Labeled with lot number, date of manufacture, expiration, composition and origin; analysis certification. (Item 01 SAPAR 063/2016) Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit supply: BOTTLE 19 - FEEDER QUIMICO Packaged in bottle with screw cap; Labeled with lot number, date of manufacture, expiration, composition and origin; analysis certification. (Item 02 SAPAR 063/2016) Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit supply: BOTTLE 20 - FEEDER QUIMICO Packaged in bottle with screw cap; Labeled with lot number, date of manufacture, expiration, composition and origin; analysis certification. (Item 03 SAPAR 063/2016) Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit fornecim

Electronic Auction - Purchase of inputs, such as ethyl acetate, acetone, balm, agarose, dyes, etc., for the Parasitology Section of the IEC.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published August 17, 2015


Electronic Auction - Purchase of raw materials for laboratory diagnosis of Zika virus and Dengue molecular biology.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published December 2, 2015

1 - CHEMICAL FEEDER must be purified by HPLC. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 80 Unit Supply: TUBE 2 - CHEMICAL FEEDER The minimum income in the range of 100 nM should be 4-6 OD. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 120 Unit Supply: TUBE 3 - CHEMICAL FEEDER The minimum income in the range of 100 nM should be 4-6 OD. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 120 Unit Supply: TUBE 4 - CHEMICAL FEEDER

Electronic Auction - Purchase of supplies for laboratory (bottles, kits for PCR, GOTAQ, oligonucleotides, etc.).

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published November 12, 2015

1 - CHEMICAL FEEDER With valid for at least one year at the time of delivery. (Item 01 SAHEP 019/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit of delivery: Kit 2 - CHEMICAL FEEDER Wizard Genomic DNA Purification 500rx300uL kit (Kit). (Item 01 SAPAR 019/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 7 Unit of delivery: Kit 3 - CHEMICAL FEEDER Go coloress Taq Master Mix, 5 mL (Kit) for 1000 reactions. (Item 02 SAPAR 019/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of delivery: Kit 4 - CHEMICAL FEEDER Diamond Nucleic Acid Dye, 500uL (Item 03 SAPAR 019/2015) Treatment differentiated: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: Bottle 5 - CHEMICAL FEEDER System 100 reactions or similar product that incorporates the methodology of needs in which the product will be used. (Item 01 SAPAR 020/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 7 Unit of delivery: Kit 6 - CHEMICAL FEEDER

Electronic Auction - Purchase of primers, antiserum, set of DNTP, enzymes and certified samples for research in various sections of IEC.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published January 21, 2016

1 - CHEMICAL FEEDER Other specifications in the tender (item 01 SAARB 059/2015) Differential Treatment: -. Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit of supply: TUBE 2 - CHEMICAL FEEDER Other specifications in the tender. (item 02 SAARB 059/2015) Differential Treatment: - Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit of supply: TUBE 3 - FEEDER CHEMICAL SYNTHETIC GENE SEQUENCE OF CLONING IN 1479 bp plasmid pUCIDT VECTOR (AMP) - CLONE VNO (1479pb) custom-optimized synthetic gene cloning vector with the ampicillin resistance for use in vitro transcription reactions. Tip Brand Name: Integrated DNA Technologies - RTD, or equivalent, provided that it meets the description, technical specifications and form of presentation. Presentation: Tube containing plasmids liofilizados.Demais specifications in the tender (item 03 SAARB 059/2015) Differential Treatment: -. Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit of supply: TUBE 4 - CHEMICAL FEEDER Other specifications on notice (item 04 SAARB 059/2015) Differential Treatment: -. Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit of supply: TUBE 5 - CHEMICAL FEEDER Other specifications in the tender (item 05 SAARB 059/2015). Differential Treatment: - Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit of supply: TUBE 6 - CHEMICAL FEEDER Other specifications in the tender (item 06 SAARB 059/2015) Differential Treatment: -. Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit of supply:. TUBE 7 - CHEMICAL FEEDER Other specifications in the tender (item 07 SAARB 059/2015) Differential Treatment: - Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit supply: TUBE 8 - CHEMICAL FEEDER Other specifications in the tender (item 08 SAARB 059/2015) Differential Treatment:. - Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit of supply: TUBE 9 - CHEMICAL FEEDER Other specifications on notice (item 09 SAARB 059/2015) Differential Treatment: -. Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 1 Unit of supply:. TUBE 10 - CHEMICAL FEEDER Other specifications in the tender (item 10 SAARB 059/2015) Differential Treatment: - Decree 7174 Applicability: - Applicability Margin of Preference: No Number: 10 units supply: TUBE 11 - CHEMICAL FEEDER Other specifications in the tender (item 11 SAARB 059/2015) Differential Treatment: -. Decree 7174 Applicability: - Applicability Margin of Preference: No Number: 10 units supply:. TUBE 12 - CHEMICAL FEEDER Other specifications in the tender (item 12 SAARB 059/2015) Differential Treatment: - Decree 7174 Applicability: - Applicability Margin of Preference: No Quantity: 10 Unit supply: TUBE 13 - CHEMICAL FEEDER Other specifications in the tender (item 13 SAARB 059/2015) Differential Treatment:. - Decree 7174 Applicability: - Applicability Margin of Preference: No Number: 6 Unit of supply: TUBE 14 - CHEMICAL FEEDER Other specifications on notice (item 14 SAARB 059/2015) Differential Treatment: -. Decree 7174 Applicability: - Applicability Margin of Preference: No Number: 6 Unit of supply: TUBE 15 - CHEMICAL FEEDER Antiserum for Vibrio cholerae O1 (polyvalent) 3 mL. (item 01 SABAC 024/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 4 Unit of supply: BOTTLE 16 - CHEMICAL FEEDER Antiserum for Vibrio cholerae O139. (item 02 SABAC 024/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: BOTTLE 17 - CHEMICAL FEEDER 57151, vial of 3 ml (item 03 SABAC 024/2015). Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: BOTTLE 18 - CHEMICAL FEEDER 57183, vial of 3 ml. (item 04 SABAC 024/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: BOTTLE 19 - CHEMICAL FEEDER 57171. (item 05 SABAC 024/2015) Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: BOTTLE 20 - CHEMICAL FEEDER 57182 (item 06 SABAC 024/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit Supply: BOTTLE 21 - CHEMICAL FEEDER Antiserum Vibrio cholerae O1 Inaba bottle with 3 ml. (item 07 SABAC 024/2015) Differential Treatment: - Aplicabil

Electronic Auction - Purchase of various materials and reagents for the Laboratory of Environment Section.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published August 17, 2015

1 - CHEMICAL FEEDER HACH No. 444.53) Meets item 1 TR SAMAM 14/2015 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: Bottle 2 - CHEMICAL FEEDER HACH No. 14070.99) Meets item 2 TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: Package 3 - CHEMICAL FEEDER HACH No. 21055.28) Meets item 3 of the TR SAMAM 14/2015 Differential treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 3 Unit Supply: Package 4 - CHEMICAL FEEDER HACH No. 22121.29) Meets item 4 TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 18 Unit Supply: Bottle 5 - CHEMICAL FEEDER HACH No. 22122.42) Meets item 5 of the TR SAMAM 14/2015 Differential treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 18 Unit Supply: Bottle 6 - CHEMICAL FEEDER HACH No. 12065.28) Meets item 6 TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: Packages 7 - CHEMICAL FEEDER HACH No. 2125.99) Meets item 7 of TR SAMAM 14/2015 Differential treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 30 Unit Supply: Packages 8 - CHEMICAL FEEDER HACH No. 2219.69). Meets item 8 TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 4 Unit of supply: Package 9 - CHEMICAL FEEDER HACH No. 14065.99). Meets item 9 TR SAMAM 14/2015 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 40 Unit Supply: Packages 10 - CHEMICAL FEEDER HACH No. 14034.28) item meets 10 TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Packages 11 - CHEMICAL FEEDER HACH No. 14119.99). Item meets 11 TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 30 Supply unit: Packages 12 - CHEMICAL FEEDER HACH No. 22417.32) Meets item 12 of the TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 18 Unit Supply: Bottle 13 - CHEMICAL FEEDER HACH No. 22418.32) Meets item 13 of the TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 18 Unit Supply: Bottle 14 - CHEMICAL FEEDER HACH No. 22419.26) Meets item 14 of the TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 15 - CHEMICAL FEEDER HACH No. 22297.26) Meets item 15 T SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 16 - CHEMICAL FEEDER HACH No. 14163.69) Meets item 16 of the TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 16 Unit Supply: Packages 17 - CHEMICAL FEEDER HACH No. 29622.66) Meets item 17 of the TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 60 Unit Supply: Packages 18 - CHEMICAL FEEDER HACH No. 1816.32) Meets item 18 of the TR SAMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 19 - CHEMICAL FEEDER HACH No. 1817.32) Meets item 19 of the TR SASMAM 14/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 20 - CHEMICAL FEEDER HACH N 405.20) Meets item 1 TR SAMAM 17/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: Bottle 21 - CHEMICAL FEEDER BOTTLE 500 ml / SOLUTION WITH CERTIFICATION AND TRACEABILITY NIST; 12 MONTH DATE

Electronic Auction - laboratory use material acquisition (membrane, acetic acid, ethyl alcohol, oligonucleotides, etc.) intended for Parasitology Section of the IEC.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published November 17, 2015

1 - FEEDER CHEMICAL PACK WITH 100 UNITS. Meets item 1 T Sapar 29/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 4 Unit of supply: Package 2 - CHEMICAL FEEDER PACK WITH 100 UNITS. Meets item 2 TR SAMAM 29/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 4 Unit of supply: Package 3 - FEEDER CHEMICAL PACK WITH 100 UNITS. Meets item 3 of the TR SAPAR 29/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Package 4 - CHEMICAL FEEDER bottle with 1000ml. Meets item 1 TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 5 - CHEMICAL FEEDER bottle containing 1kg. Meets item 2 TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 6 - CHEMICAL FEEDER bottle containing 1 liter. Meets item 3 of the TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 7 - CHEMICAL FEEDER bottle containing 1 liter. Meets item 4 TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 8 - CHEMICAL FEEDER bottle containing 1 liter. Meets item 5 of the TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 9 - CHEMICAL FEEDER bottle containing 100 g. Meets item 6 TR Sapar 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 10 - CHEMICAL FEEDER bottle containing 1.5 ml. Meets item 7 of TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 11 - CHEMICAL FEEDER bottle containing 1000 g. Meets item 8 TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 12 - CHEMICAL FEEDER bottle containing 1kg. Meets item 9 TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 13 - CHEMICAL FEEDER bottle containing 500gr. Meets item 10 of the TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 14 - CHEMICAL FEEDER bottle containing 1 liter. Item meets 11 TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 15 - CHEMICAL FEEDER bottle containing 100 gr. Item meets 12 TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 16 - CHEMICAL FEEDER bottle containing 1 liter. Meets item 13 of the TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 17 - CHEMICAL FEEDER bottle containing 1000 ml. Attend item 14 of the TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 18 - CHEMICAL FEEDER Silver nitrate PA bottle containing 500g. Item meets 15 TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 19 - CHEMICAL FEEDER bottle containing 1 liter. Item meets 16 TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 20 - CHEMICAL FEEDER bottle containing 100g. Meets item 17 of the TR SAPAR 39/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: f

Electronic Auction - Purchase of supplies for laboratory (vials, PCR kits, GOTAQ, oligonucleotides, etc.) to various sectors of the IEC.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published September 2, 2015

1 - CHEMICAL FEEDER 259791) - (Item 01 SABAC 030/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 50 Unit Supply: Bottle 2 - CHEMICAL FEEDER 259 794) (Item 02 SABAC 030 / 2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 50 Unit Supply: Bottle 3 - CHEMICAL FEEDER With valid for at least one year at the time of delivery. (Item 01 SAHEP 019/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit of delivery: Kit 4 - CHEMICAL FEEDER Wizard Genomic DNA Purification 500rx300uL kit (Kit). (Item 01 SAPAR 019/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 7 Unit of delivery: Kit 5 - CHEMICAL FEEDER Go coloress Taq Master Mix, 5 mL (Kit) for 1000 reactions. (Item 02 SAPAR 019/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of delivery: Kit 6 - CHEMICAL FEEDER Diamond Nucleic Acid Dye, 500uL (Item 03 SAPAR 019/2015) Treatment differentiated: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: Bottle 7 - CHEMICAL FEEDER System 100 reactions or similar product that incorporates the methodology of needs in which the product will be used. (Item 01 SAPAR 020/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 7 Unit of delivery: Kit 8 - CHEMICAL FEEDER

Electronic Auction - Purchase of supplies for laboratories (enzymes, solutions, oligonucleotides, bicarbonate, chloride, acetone, etc.) for the various sections of the IEC.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published August 3, 2015

1 - CHEMICAL FEEDER Quantity: 40,000 units. Meets item 1 TR SAHEP 05/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 2 - CHEMICAL FEEDER Quantity: 5000 units. Meets item 2 TR SAHEp 05/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 8 Unit of supply: Box 3 - CHEMICAL FEEDER Qty: 500 reactions. Meets item 3 of the TR SAHEP 05/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 4 - CHEMICAL FEEDER 1.1X concentration sufficient for 100 reactions of 50ul each. Meets item 4 T SAHEP 05/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Box 5 - CHEMICAL FEEDER bottle with 1 liter of solution ready for use Meets item 1 TR SABMI 08/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: 6 liter - CHEMICAL FEEDER Stock solution of May-Grünwald. Bottle with 1 liter of solution ready for use Meets item 2 TR SBMI 08/2015 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: 7 liters - CHEMICAL FEEDER bottle with 250 ml Meets item 3 of the TR SABMI 08/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit Supply: 8 liters - CHEMICAL FEEDER Synthesis of labeled oligonucleotide (primer) synthesized for use in sequencing reactions Applied Biosystems 3130, 3500. meets only item TR SABMI 43/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 600 Unit Supply: 9 bases - CHEMICAL FEEDER BICARBONATE SODIUM PA ACS (NaHCO3), PHYSICAL APPEARANCE WHITE POWDER, FINO, MW: 84.01, CONTENT MINIMUM 99.7%, heavy metals like lead MAXIMUM 5 PPM, CHLORIDE MAXIMUM 0.003% phosphates MAXIMUM 0.001%, 0.001% MAXIMUM IRON, BOTTLE WITH 500G Meets item 1 TR SVIR 32/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 10 - CHEMICAL FEEDER BOTTLE 5G heed has 2 TR SAVIR 32/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit of supply: Unit 11 - CHEMICAL FEEDER BOTTLE 500 G Meets item 3 of the TR SAVIR 32/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Unit 12 - CHEMICAL FEEDER ACS (NaCl), ISO, MINIMUM CONTENT 99.5%, HEAVY METALS AS LEAD 13 - FEEDER CHEMICAL PHOSPHATE POTASSIUM PA ACS, (KH2PO4); PHYSICAL APPEARANCE WHITE CRYSTALLINE POWDER, ODOURLESS, monobasic ANHYDROUS, MOLECULAR WEIGHT 136.09 G / MOL, PURITY CONTENT MINIMUM OF 99%, 500G BOTTLE. Meets item 5 of the TR SAVIR 32/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Unit 14 - CHEMICAL FEEDER SODIUM PHOSPHATE DIBASIC, PA ACS (Na2HPO4), MOLECULAR WEIGHT 141.96, CONTENT MINIMUM 97% BOTTLE 500 g Meets item 6 TR SAVIR 32/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Unit 15 - CHEMICAL FEEDER 250G BOTTLE Meets item 7 of TR SAVIR 32/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 16 - CHEMICAL FEEDER BOTTLE 500G. Meets item 8 T SAVIR 32/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 17 - CHEMICAL FEEDER BOTTLE 500G. Meets item 9 T SAVIR 32/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 18 - CHEMICAL FEEDER ACS IT (HCl), PHYSICAL APPEARANCE clear liquid, steaming, COLOURLESS, MW: 36.46, MINIMUM CONTENT OF 37% MINIMUM LEVEL OF PURITY 99%, METAL MAXIMUM CONTENT AS LEAD 19 - CHEMICAL FEEDER WITH BOTTLE 1000 ML Meets item 11 of the TR SAVIR 32/2015. Differential Treatment: -

Electronic Auction - Purchase of reagent kits and solutions (potassium biphthalate, IgG kit, palladium solution, determination of hormone CBA kit, etc) for the Environment Section of the IEC.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published December 4, 2015

1 - CHEMICAL FEEDER biphthalate Potassium PA, 250 grams Meets item 1 TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 2 - CHEMICAL FEEDER Sodium Carbonate Anhydrous PA, 250 grams Meets item 2 TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 3 - CHEMICAL FEEDER Sodium Nitrate PA, 250 grams Meets item 3 of the TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 4 - Ammonium Chloride CHEMICAL FEEDER PA, 250 grams Meets item 4 TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 5 - CHEMICAL FEEDER Phosphoric Acid 85% PA, 1 liter Meets item 5 of the TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 6 - CHEMICAL FEEDER Perchlorate Magnesium PA, 250 grams Meets item 5 of the TR SAMAM 50/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 7 - CHEMICAL FEEDER Rubella, METHOD ELISA SIEMENS FOR 96 TESTS. Enzygnost Anti-rubella virus IgG IgG ANTIBODY HUMAN rubella DADE ELISA Qualitative and quantitative determination of antibodies to human immunoglobulin G (IgG) against the rubella virus in serum and plasma. Presentation: kit for 96 tests Manufacturer: Siemens Healthcare Diagnostics Inc. Brand: Siemens Healthcare Diagnostics Inc. Registration Ministry of Health number: 10345161486. ​​Meets item 1 TR SAMAM 99/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 28 Unit Supply: 8 boxes - CHEMICAL FEEDER MEASLES, METHOD ELISA SIEMENS FOR 96 TESTS. Enzygnost Anti measles virus IGG DADE ELISA immunoassay for the qualitative and quantitative determination of human IgG antibodies to measles virus in serum and human plasma. Presentation: 96 tests Kit Manufacturer: Siemens Healthcare Diagnostics Inc. Brand: Siemens Healthcare Diagnostics Inc. Registration Ministry of Health number: 10345161292. Meets item 2 TR SAMAM 99/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 28 Unit supplies: boxes 9 - CHEMICAL FEEDER packaged in high quality polyethylene bottle to reduce interferences and possible contamination. Meets only item TR SAMAM 100/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit Supply: Bottle 10 - CHEMICAL FEEDER kits for determination of Leptin hormone in human serum, EIA method, for 96 tests. Meets only item TR SAMAM 121/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units of delivery: Kit 11 - CHEMICAL FEEDER 550 749 Meets item 1 TR SAMAM 126/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 6 Unit of delivery: Kit 12 - CHEMICAL FEEDER 551 809 Meets item 2 TR SAMAM 126/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 6 Unit of delivery: Kit 13 - CHEMICAL FEEDER 560484 Meets item 3 of the TR SAMAM 126/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 6 Unit of delivery: kit

Electronic Auction - Purchase of solutions and reagents.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published November 18, 2015

1 - CHEMICAL FEEDER 1024450250 Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: LITER 2 - CHEMICAL FEEDER Presentation: 100ml bottle. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 4 Unit of supply: Bottle 3 - CHEMICAL FEEDER Presentation bottle of 500ml. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 5 Unit of supply: Bottle 4 - CHEMICAL FEEDER (Item 03 TR SAVIR 34/2015) Ammonium Acetate PA / ACS (Crystal), 500 grams Treatment Differential: Type I - Exclusive participation of ME / EPP Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 5 - FEEDER CHEMICAL Presentation: 1L Treatment Distinctive Bottle: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: 6 liter - CHEMICAL FEEDER Presentation: Bottle with 500g. Differential Treatment: Type I - Exclusive participation of ME / EPP Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 7 - FEEDER CHEMICAL PRESENTATION: BOTTLE OF 1 LITRE, LOG MS, NO LABEL SHOULD CONTAIN THE DATE OF MANUFACTURE / DATE DATE / SOURCE / CHEMICAL LIABLE / No LOT. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 100 Unit Supply: 8 liters - CHEMICAL FEEDER (Item 02 TR SOALM 09/2015) ACETONE BP APPLICATION: ANALYSIS LABORATORY , FEATURES: PHYSICAL APPEARANCE COLOURLESS, MOLECULAR FORMULA CH3COCH3, MOLECULAR WEIGHT 58.08 GRAMS / MOL, MINIMUM PURITY 99.8% PRESENTATION: 1 LITER BOTTLE WITH, LOG MS, NO LABEL SHALL CONTAIN THE DATE OF MANUFACTURE / DATA DATE / SOURCE / CHEMICAL LIABLE / No LOT. Merck brand. Request sample of the material before delivery. Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 100 Unit Supply: 9 liter - CHEMICAL FEEDER (Item 01 TR SACPA 08/2015) ketamine hydrochloride solution 10mg injection (10 ml vial) (animal treatment only). Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 100 Unit Supply: Bottle 10 - CHEMICAL FEEDER (Item 02 TR SACPA 08/2015) Xylazine hydrochloride 20mg solution for injection (10 ml vial) (animal treatment only). Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 100 Unit Supply: Bottle 11 - CHEMICAL FEEDER (Item 03 TR SACPA 008/2015) Isofurano inhaled anesthetic (with bottle 100 ml). Differential Treatment: Type I - Exclusive participation of ME / EPP Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 150 Unit Supply: Bottle

Electronic Auction - Purchase of materials for laboratory (half Leibovitz, centrifugal solution, reagents, antisera, bottles, etc.) for various sections of IEC.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published July 22, 2015

1 - CHEMICAL FEEDER Delivery split in 2 times. Meets item 1 TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 6 Unit of supply: Cx 2 - CHEMICAL FEEDER DPBS Phosphate Buffered Saline Dulbeccos s 1X without calcium without magnesium and without phenol red, bottle with 500 ml , GIBCO / Life Brand. Meets item 2 TR SAARB 42/2015 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 8 Unit of supply: Unit 3 - CHEMICAL FEEDER split Delivery in 2 times. Meets item 3 of the TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 4 Unit of supply: Box 4 - CHEMICAL FEEDER With 4500 mg / L of glucose, L-glutamine, without sodium bicarbonate, Used for cell culture. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Box 5 - CHEMICAL FEEDER minimum validity of 12 months. Meets item 5 of the TR SAARB 42/2015 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 11 Unit of supply: Unit 6 - CHEMICAL FEEDER Delivery in installments twice. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 15 Unit of supply: Unit 7 - CHEMICAL FEEDER box with 10 units (10 x 1 liter). Meets item 7 of TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Unit 8 - CHEMICAL FEEDER Dehydrated CAPPEL Brand. The validity of these products shall be at least 12 months. Meets item 8 TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 3 Unit of supply: Unit 9 - CHEMICAL FEEDER Delivery in installments twice. Meets item 9 TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Unit 10 - CHEMICAL FEEDER Delivery in installments twice Meets item 10 of the TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 7 Unit of supply: Unit 11 - CHEMICAL FEEDER minimum Validity: 12 months. Description: Used to remove contamination of cell cultures by mycoplasma. Meets item 1 TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 12 - CHEMICAL FEEDER Delivery in installments twice. Description: solution for cleaning and elimination of mycoplasma contamination of lab surfaces and apparatuses, including banks, incubators, stands, boxes storage cells and liquid nitrogen containers. Item meets 12 TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Unit 13 - CHEMICAL FEEDER minimum Validity: 12 months. Attend item 13 of the TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 14 - CHEMICAL FEEDER minimum Validity: 12 months. Item meets 14 TR SAARB 42/2015 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Unit 15 - CHEMICAL FEEDER minimum Validity: 12 months. Item meets 15 TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 16 - CHEMICAL FEEDER minimum Validity: 12 months. Item meets 16 TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 17 - CHEMICAL FEEDER Delivery in installments twice. Meets item 17 of the TR SAARB 42/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Unit 18 - CHEMICAL FEEDER 100 ml Description: Used to freezing and conservation in liquid nitrogen cell culture. Item meets 18 TR SAARB 42/2015

Electronic Auction - Purchase of laboratory materials such: Kits, Taq DNA, ultra pure water, polymer, etc. for the Virology Section of the IEC.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published June 1, 2015

1 - CHEMICAL FEEDER kit for 250 reactions yield greater than 90% recovery. Meets item 1 TR SAVIR 19/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 3 Unit of delivery: Kit 2 - CHEMICAL FEEDER Kit 50 reactions. Meets item 2 TR SAVIR 19/2015 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: 3 kit - CHEMICAL FEEDER sufficient for 50 reactions. Meets item 3 of the TR SAVIR 19/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 5 Unit Supply: 4 kit - CHEMICAL FEEDER sufficient for 50 reactions. Meets item 4 TR SAVIR 19/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 5 Unit of delivery: kit 5 - CHEMICAL FEEDER system to isolate any plasmid smaller E.coli 20,000 bp in size. 50 insulation from 1? 10ml culture. Meets item 5 of the TR SAVIR 19/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 4 Unit of delivery: Kit 6 - CHEMICAL FEEDER SUPERSCRIPT II REVERSE TRANSCRIPTASE. Flask containing 10,000 units concentration of 200U / L. Meets item 1 TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: Bottle 7 - CHEMICAL FEEDER bottle with 500 units Meets item 2 TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 20 Unit Supply: Bottle 8 - CHEMICAL FEEDER contains four bottles each of 100 mM concentration. Meets item 3 of the TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 3 Unit Supply: Bottle 9 - CHEMICAL FEEDER bottle with 100 micrograms concentration of 100 g / L and volume of 100 L. Meets item 4 TR SAVIR 27 / 2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: Bottle 10 - CHEMICAL FEEDER bottle 250 micrograms. With concentration of 1 g / L and volume of 50 L. Meets item 5 of the TR SAVIR 27/2015 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 6 Unit Supply: Bottle 11 - CHEMICAL FEEDER bottle 100 mg Meets item 6 TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 4 Unit of supply: Bottle 12 - CHEMICAL FEEDER Supplied in 3 vials containing 1 ml each. Meets item 7 TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 6 Unit of supply: Bottle 13 - CHEMICAL FEEDER Syber Safe gel stain. Supplied in a 400 L jar Meets item 8 TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 4 Unit of supply: Bottle 14 - CHEMICAL FEEDER Ribonuclease Inhibitor (cloned) 2500U (40U / l). Meets item 9 TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 15 Unit Supply: Bottle 15 - CHEMICAL FEEDER bottle with 500 units Meets item 10 of the TR SAVIR 27/2015 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: Bottle 16 - CHEMICAL FEEDER Formamide HI DI. Bottle containing 25 ml to 80corridas. Meets item 11 of the TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 17 - CHEMICAL FEEDER bottle with 10,000 units at a concentration of 200 U / L Meets item 12 of the TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: Bottle 18 - CHEMICAL FEEDER bottle with volume of 200 L in 10 mM Tris-HCl (pH 7.5), 1 mM EDTA. Meets item 13 of the TR SAVIR 27/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 4 Unit

Electronic Auction - Purchase of various primers for the Section of Virology.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published July 31, 2015

1 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: adeno F: 5 - CWTACATGCACATCKCSGG-3? Meets item 1 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 2 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: adeno A: 5 - CRCGGGCRAAYTGCACCAG-3? Meets item 2 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 3 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: COG1F 5 CGY TGG ATG CGN TTY CAT GA-3? Meets item 3 of the TR SAVIR 24/2015 Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 4 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: COG1R 5 CTT AGA? CGC CAT CAT CAT TYA C-3? Meets item 4 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 5 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: COG2F 5 CAR GAR BCN ATG TTY AGR TGG ATG AG-3? ? Meets item 5 of the TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 6 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: COG2R 5 TCG ACG TCA CCA TCT TTC ACA-3? Meets item 6 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 7 - CHEMICAL FEEDER ACC ATC TWC ACR TRA CCC TCT ATG AG-3? Meets item 7 of TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 8 - CHEMICAL FEEDER GGT CAC ATA ACG CCC CTA TAG C-3? Meets item 8 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 9 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: EV Realty (S) 5 GGC CCC ATG TGA CGG CTA ATC? C 3? Meets item 9 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 10 - CHEMICAL FEEDER GCG ATT GTC ACC ATW AGC AGY CA 3? Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 11 - CHEMICAL FEEDER probes to be synthesized 6,000 picomol NoroG1a 5 VIC-AGA TYG CGA TCY CCT GTC CA-TAMRA-3? ? Item meets 11 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 12 - CHEMICAL FEEDER probes to be synthesized 6,000 picomol NoroG1b 5 VIC ​​TCG CGG-AGA TCT CCT GTC CA-TAMRA-3? ? Item meets 12 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 13 - CHEMICAL FEEDER FAM-TGG GAG GGC GAT AAT CGC CT-TAMRA-3? Meets item 13 of the TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 14 - CHEMICAL FEEDER probes to be synthesized 6,000 picomol Adeno 5-FAM-TAMRA 3 CCGGGCTCAGGTACTCCGAGGCGTCCT? Item meets 14 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 15 - CHEMICAL FEEDER VIC-AGT TAA AAG CTG CTA ACA AA-MGBNFQ TCA Meets item 15 of the TR SAVIR 24/2015 Differential Treatment : - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 16 - CHEMICAL FEEDER probes to be synthesized 6,000 picomol Panev Probe 5-FAM GCC ACT ACT TTG GGW GTC CGT GT-MGB NQF 3 ? Item meets 16 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 17 - CHEMICAL FEEDER ATA CCA CTA TGC AGA TGA YTA 3? Meets item 1 TR SAVIR 25/2015. Differential Treatment: - Applicability Decree 7174: No Applicability margin prefer

Electronic Auction - Purchase of various primers for the Section of Virology

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published September 8, 2015

1 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: adeno F: 5 - CWTACATGCACATCKCSGG-3? Meets item 1 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 2 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: adeno A: 5 - CRCGGGCRAAYTGCACCAG-3? Meets item 2 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 3 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: COG1F 5 CGY TGG ATG CGN TTY CAT GA-3? Meets item 3 of the TR SAVIR 24/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Unit 4 - FEEDER CHEMICAL initiators to be synthesized to 80,000 peak mol: COG1R 5 CTT AGA CGC CAT CAT CAT TYA C-3? Meets item 4 TR SAVIR 24/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Unit 5 - FEEDER CHEMICAL initiators to be synthesized to 80,000 peak mol: COG2F 5 CAR GAR BCN ATG TTY AGR TGG ATG AG-3? ? Meets item 5 of the TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 6 - CHEMICAL FEEDER initiators to be synthesized to 80,000 peak mol: COG2R 5 TCG ACG TCA CCA TCT TTC ACA-3? Meets item 6 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 7 - CHEMICAL FEEDER ACC ATC TWC ACR TRA CCC TCT ATG AG-3? Meets item 7 of TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 8 - CHEMICAL FEEDER GGT CAC ATA ACG CCC CTA TAG C-3? Meets item 8 TR SAVIR 24/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Unit 9 - FEEDER CHEMICAL initiators to be synthesized to 80,000 peak mol: EV Realty (S) 5 GGC CCC TGA ATG CGG CTA ATC? C 3? Meets item 9 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 10 - CHEMICAL FEEDER GCG ATT GTC ACC ATW AGC AGY CA 3? Meets item 10 of the TR SAVIR 24/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Unit 11 - FEEDER CHEMICAL probes to be synthesized 6,000 picomol NoroG1a 5 VIC-AGA TYG CGA TCY CCT GTC CA-TAMRA-3? ? Item meets 11 TR SAVIR 24/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Unit 12 - FEEDER CHEMICAL probes to be synthesized 6,000 picomol NoroG1b 5 VIC-AGA TCG CGG TCT CCT GTC CA-TAMRA-3? ? Item meets 12 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 13 - CHEMICAL FEEDER FAM-TGG GAG GGC GAT AAT CGC CT-TAMRA-3? Meets item 13 of the TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 14 - CHEMICAL FEEDER probes to be synthesized 6,000 picomol Adeno 5-FAM-TAMRA 3 CCGGGCTCAGGTACTCCGAGGCGTCCT? Item meets 14 T SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 1 supply unit: Unit 15 - CHEMICAL FEEDER VIC-AGT TAA AAG CTG CTA ACA AA-MGBNFQ TCA Meets item 15 of the TR SAVIR 24/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Unit 16 - FEEDER CHEMICAL probes to be synthesized 6,000 picomol Panev Probe 5 FAM-GCC ACT ACT TTG GGW GTC CGT GT-MGB? NQF 3? Item meets 16 TR SAVIR 24/2015. Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Unit 17 - CHEMICAL FEEDER ATA CCA CTA TGC AGA TGA YTA 3? Meets item 1 TR SAVIR 25/2015. Differential Treatment: - Applicability Decree 7174:

Electronic Auction - laboratory use material acquisition, for the IEC sections (AC acetic, amphotericin, assay, Conj, reagents, dyes and solutions..).

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published June 5, 2015

1 - CHEMICAL FEEDER Method: colorimetric test scale. Meets item 1 TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit of supply: box with 100 pcs. 2 - CHEMICAL FEEDER Glacial Acetic Acid, with certificate of analysis, Suprapur reagent minimum content of 99%. Meets item 2 TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 3 - CHEMICAL FEEDER 97%, density> 1 g, Vapor Pressure 4 - CHEMICAL FEEDER 99% (T), low impurities. Meets item 4 TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 5 - CHEMICAL FEEDER Citric Acid Anhydrous, with certificate of analysis, low level of impurities, melting point (50 g / l, ? H O, 25 C) Vapor Pressure 6 - CHEMICAL FEEDER EDTA- also known as Ethylenedinitrilotetraacetic acid; with certificate of analysis, PA assay grade from 99.4 to 100.6% (T), low level of impurities. Meets item 6 TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 7 - CHEMICAL FEEDER 99.5% (T), low level of impurities, Insoluble substances? 0.005%, Chloride (Cl)? 0.0005% Ca (calcium)? 0.005%, Cu (copper)? 0.0005% Fe (iron)? 0.0005%, K (potassium)? 0.005% Na (sodium)? 0.02%. Meets item 7 TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 8 - CHEMICAL FEEDER 99% (T), low level of impurities. Meets item 8 TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 1 supply unit: bottle 9 - CHEMICAL FEEDER color change in pH = 3.2 to pH = 4.4 and red to yellow. Meets item 9 TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 10 - CHEMICAL FEEDER 95-98% (T), low level of impurities, pH = 1.2 to 5 g / l , Melting Point 3 ° C Boiling Point 290 ¨C? lit, Vapor Pressure 1.33 hPa to 145.8 C Density 1.84 g / cm3 at 25 ° C. Meets item 10 of the TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 11 - CHEMICAL FEEDER 97%, Ph = 7.0 1.0, Boiling point: 78,4ºC, Melting point : - 114,4ºC, Flash Point: 13 ° C, Density 789.3 kg / m3 Vapor Pressure 40 mmHg (at 19 ° C) Vapour density: 1.59 (air = 1), Impurities compounds 0.001% N. Meets item 11 of the TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 12 - CHEMICAL FEEDER Melting point: 217 - 218ºC, Solubility in water: insoluble / ethanol: 30 g / l, - Decomposition temperature: 225 ° C. Meets item 12 of the TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Number: 1 supply unit: bottle 13 - CHEMICAL FEEDER color change: pH = 8.0 to pH 10.0 colorless to pink (pink). Meets item 13 of the TR SAMAM 58/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 1 Unit of supply: Bottle 14 - CHEMICAL FEEDER amphotericin B, liquid, 250 g / mL, tested for cell culture flask containing 20 mL, Brand: Invitrogen, Cat # 15290-018. Meets item 1 TR SAVIR 05/2015 Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 15 - CHEMICAL FEEDER HEPES 1M, tested for cell cultivation, Brand: Gibco, Ref : 15630-106, 20mL Ans item 2 TR SAVIR 05/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 20 Unit Supply: Bottle 16 - CHEMICAL FEEDER bottle with 100 ml Meets item 3 of the TR SAVIR 05/2015. Differential Treatment: - Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 10 Unit Supply: Bottle 17 - CHEMICAL FEEDER Immediate delivery Meets item 4 TR SAVIR 05/2015. Differential Treatment: - Applicability Decree 7174: No Applicability margin Prefe

Electronic Auction - Purchase of various reagents for DNA sequencing and RNA

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published March 26, 2015

1 - CHEMICAL ANALYZER The validity of these products shall be at least 6 months upon delivery. Meets item 1 of PBS SAARB 58/2014. Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 48 Unit of supply: Kit 2 - CHEMICAL ANALYZER The validity of these products shall be at least 6 months upon delivery Meets item 2 of the PBS SAARB 58 / 2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 64 Unit of supply: Kit 3 - ANALYZER CHEMICAL The validity of these products shall be at least 6 months upon delivery. Meets item 3 of PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 64 Unit of supply: Kit 4 - ANALYZER CHEMICAL The validity of these products shall be a minimum of 6 months in the act delivery. Ans item 4 of the PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 4 Unit of supply: Kit 5 - ANALYZER CHEMICAL The validity of these products shall be a minimum of 6 months in the act delivery .. Meets item 5 of the PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 10 Unit of supply: Kit 6 - CHEMICAL ANALYZER The validity of these products shall be a minimum of 6 months at the time of delivery. Meets item 6 of PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 30 Unit of supply: Kit 7 - CHEMICAL ANALYZER The validity of these products shall be a minimum of 6 months in the act delivery .. Meets item 7 of PBS Aarb 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Number: 150 Unit of supply: Kit 8 - CHEMICAL ANALYZER The validity of these products shall be a minimum of 6 months at the time of delivery. Meets item 8 of PBS SAARB 58/2014. Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 20 Unit of supply: Kit 9 - CHEMICAL ANALYZER The validity of these products shall be a minimum of six months on delivery .. Meets item 9 of PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Number: 170 Unit of supply: Kit 10 - CHEMICAL ANALYZER The validity of these products shall be a minimum of six months on delivery .. Meets item 10 of PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 74 Unit of supply: Kit 11 - CHEMICAL ANALYZER The validity of these products shall be at least 6 months at the time of delivery. Meets item 11 of pBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 50 Unit of supply: Kit 12 - CHEMICAL ANALYZER The validity of these products shall be a minimum of 6 months in the act delivery. Meets item 12 of PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 16 Unit of supply: Kit 13 - CHEMICAL ANALYZER The validity of these products shall be a minimum of 6 months in the act delivery. Meets item 13 of PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 20 Unit of supply: Kit 14 - CHEMICAL ANALYZER The validity of these products shall be a minimum of 6 months in the act delivery .. Meets item 14 of PBS SAARB 58/2014. Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 80 Unit of supply: Kit 15 - CHEMICAL ANALYZER The validity of these products shall be at least 6 months upon delivery. Meets item 15 of PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Number: 100 Unit of supply: Kit 16 - CHEMICAL ANALYZER The validity of these products shall be a minimum of 6 months in the act delivery .. Meets item 16 of PBS SAARB 58/2014 Differential Treatment: - Applicability Decree 7174: - Applicability Margin of Preference: No Quantity: 80 Unit of supply: Kit 17 - CHEMICAL ANALYZER The validity of these products shall be a minimum of 6 months

Electronic Auction - laboratory use material acquisition (ethanol, oligonucleotides, tetrodotoxin, etc) for the Section of Parasitology.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published August 31, 2015

1 - CHEMICAL FEEDER With Certificate of Analysis (Item 01 SAPAR 011/2015) Differential Treatment: -. Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 2 - CHEMICAL FEEDER Sodium chloride (NaCl) 99% PA, to molecular biology, 98%, free from DNase, Rnasee protease, bottle with 500 g, with certificate of analysis (Item 02 SAPAR 011/2015) Differential Treatment: -. Applicability Decree 7174: Applicability No Preference margin: Not Quantity: 2 Unit of supply: Bottle 3 - CHEMICAL FEEDER With Certificate of Analysis (Item 03 SAPAR 011/2015) Differential Treatment: -. Applicability Decree 7174: not Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 4 - CHEMICAL FEEDER jar with 1000 ml (Item 04 SAPAR 011/2015) Differential Treatment: -. Applicability Decree 7174: No Applicability Margin of Preference: No Number: 3 Unit Supply: Bottle 5 - CHEMICAL FEEDER With certificate of analysis. (Item 05 SAPAR 011/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 6 - CHEMICAL FEEDER With certificate of analysis. (Item 06 SAPAR 011/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 7 - CHEMICAL FEEDER disodium phosphate dihydrate, (Na2HPO4.2H2O), ACS reagent, 99, 0%, MW = 177.99, bottle with 500 g, with certificate of analysis. (Item 07 SAPAR 011/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 8 - CHEMICAL FEEDER With certificate of analysis. (Item 08 SAPAR 011/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 1 supply unit: bottle 9 - CHEMICAL FEEDER Functional group R-CH 2 N (CH2 COO-) 2. (Item 09 SAPAR 011/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 10 - CHEMICAL FEEDER bottle with 1,000 ml. (Item 10 SAPAR 011/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 1 Unit of supply: Bottle 11 - CHEMICAL FEEDER box with 10 packages. (Item 11 SAPAR 011/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Box 12 - CHEMICAL FEEDER bottle with 10 ml. (Item 12 SAPAR 011/2015) Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Quantity: 2 Unit of supply: Bottle 13 - FEEDER CHEMICAL PACKAGING: PROPER BOTTLE WITH COVER SCREW; LABELING: LOT NUMBER, DATE OF MANUFACTURE, VALIDITY, COMPOSITION and origin; CERTIFICATION: WITH ANALYSIS CERTIFICATE; SHELF LIFE: MINIMUM OF ONE YEAR FROM THE DATE OF DELIVERY; SUPPLY UNIT: BOTTLE WITH 100 nmol (Item 01 SAPAR 012/2015) Differential Treatment: -. Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 14 - FEEDER CHEMICAL PACKAGING: PROPER BOTTLE WITH COVER SCREW; LABELING: LOT NUMBER, DATE OF MANUFACTURE, VALIDITY, COMPOSITION and origin; CERTIFICATION: WITH ANALYSIS CERTIFICATE; SHELF LIFE: MINIMUM OF ONE YEAR FROM THE DATE OF DELIVERY; SUPPLY UNIT: BOTTLE WITH 100 nmol (Item 02 SAPAR 012/2015) Differential Treatment: -. Applicability Decree 7174: No Applicability Margin of Preference: No Quantity: 2 Unit of supply: Bottle 15 - CHEMICAL FEEDER 0.05U synthesis scale . PACKAGING: PROPER BOTTLE WITH COVER SCREW; LABELING: LOT NUMBER, DATE OF MANUFACTURE, VALIDITY, COMPOSITION and origin; CERTIFICATION: WITH ANALYSIS CERTIFICATE; SHELF LIFE: MINIMUM OF ONE YEAR FROM THE DATE OF DELIVERY; SUPPLY UNIT: BOTTLE WITH 100 nmol (Item 03 SAPAR 012/2015) Differential Treatment: -. Applicability Decree 7174: No Applicability Margin of Preference: No Number: 4 Unit of supply: Bottle 16 - CHEMICAL FEEDER 0.05U synthesis scale . PACKAGING: PROPER BOTTLE WITH COVER SCREW; LABELING: LOT NUMBER, DATE OF MANUFACTURE, VALIDITY, COMPOSITION and origin; CERTIFICATION: WITH ANALYSIS CERTIFICATE; SHELF LIFE: MINIMUM OF ONE YEAR FROM THE DATE OF DELIVERY; SUPPLY UNIT: BOTTLE WITH 100 nmol (Item 04 SAPAR 012/2015) Treatment Diferenci.

Electronic Auction - Purchase of supplies for laboratories: fungizone, enzyme immunoassay kit, hepes 1M qubit, genemol intended for research sections.

MINISTÉRIO DA SAÚDE, SECRETARIA DE VIGILÂNCIA EM SAÚDE, Instituto Evandro Chagas - IEC, | Published December 7, 2015

1 - CHEMICAL FEEDER Fungizone Antimycotic liquid, sterile, filtered and bottle with 20ml Brand: Gibco or similar that meets the technical specifications (present technical data sheet) (Item 01 SEMIE 026/2015). Differential Treatment: - Decree 7174 Applicability: Applicability No Margin of Preference: No Number: 10 units supply: BOTTLE 2 - CHEMICAL FEEDER

Electronic Auction - Purchase of biological indicators.
